HAL Id: hal-02014487
https://hal.umontpellier.fr/hal-02014487
Submitted on 26 May 2021
HAL is a multi-disciplinary open access
archive for the deposit and dissemination of
sci-entific research documents, whether they are
pub-lished or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés.
Chain Reaction Assay for Monitoring Falciparum
Malaria Parasite Transmission in Elimination Settings
Brian Taylor, Kjerstin Lanke, Shanna Banman, Isabelle Morlais, Merribeth
Morin, Teun Bousema, Sanna Rijpma, Stephanie Yanow
To cite this version:
Brian Taylor, Kjerstin Lanke, Shanna Banman, Isabelle Morlais, Merribeth Morin, et al..
A
Direct from Blood Reverse Transcriptase Polymerase Chain Reaction Assay for Monitoring
Fal-ciparum Malaria Parasite Transmission in Elimination Settings.
American Journal of Tropical
Medicine and Hygiene, American Society of Tropical Medicine and Hygiene, 2017, 97 (2),
pp.533-543. �10.4269/ajtmh.17-0039�. �hal-02014487�
Copyright © 2017 by The American Society of Tropical Medicine and Hygiene
A Direct from Blood Reverse Transcriptase Polymerase Chain Reaction Assay for Monitoring
Falciparum Malaria Parasite Transmission in Elimination Settings
Brian J. Taylor,1Kjerstin Lanke,2Shanna L. Banman,1Isabelle Morlais,3,4Merribeth J. Morin,5Teun Bousema,2Sanna R. Rijpma,2 and Stephanie K. Yanow1,6*
1
School of Public Health, Katz Group Centre, University of Alberta, Edmonton, Alberta, Canada;2Department of Medical Microbiology, Radboud University Medical Centre, Geert Grooteplein 26-28, Nijmegen, The Netherlands;3Laboratoire de Recherche sur le
Paludisme, Organisation de Coordination pour la lutte contre les End ´emies en Afrique centrale, Yaound ´e, Cameroon;4Institut de Recherche pour le D ´eveloppement, Universit ´e de Montpellier (UMR) MIVEGEC, Montpellier Cedex, France;5PATH Malaria
Vaccine Initiative, Washington, District of Columbia;6Department of Medical Microbiology and Immunology, Katz Group Centre, University of Alberta, Edmonton, Alberta, Canada
Abstract. We describe a novel one-step reverse transcriptase real-time PCR (direct RT-PCR) for Plasmodium falciparum malaria parasites that amplifies RNA targets directly from blood. We developed the assay to identify gametocyte-specific transcripts in parasites from patient blood samples, as a means of monitoring malaria parasite transmission infield settings. To perform the test, blood is added directly to a master mix in PCR tubes and analyzed by real-time PCR. The limit of detection of the assay on both conventional and portable real-time PCR instruments was 100 parasites/mL for 18S rRNA, and 1,000 parasites/mL for asexual (PFE0065W) and gametocyte (PF14_0367, PFGEXP5) mRNA targets. The usefulness of this assay infield studies was explored in samples from individuals living in a high-transmission region in Cameroon. The sensitivity and specificity of the assay compared with a standard two-step RT-PCR was 100% for 18S rRNA on both conventional and portable instruments. For PF14_0367, the sensitivity and specificity were 85.7% and 70.0%, respectively, on the conventional instrument and 78.6% and 90%, re-spectively, on the portable instrument. The concordance for assays run on the two instruments was 100% for 18S rRNA, and 79.2% for PF14_0367, with most discrepancies resulting from samples with low transcript levels. The results show asexual and sexual stage RNA targets can be detected directly from blood samples in a simple one-step test on afield-friendly instrument. This assay may be useful for monitoring malaria parasite transmission potential in elimination settings, where sensitive diagnostics are needed to evaluate the progress of malaria eradication initiatives.
INTRODUCTION
Malaria is a disease of global concern that has been met with concerted efforts to move countries toward disease control, regional elimination, and ultimately global eradi-cation.1In 2015, an estimated 212 million malaria cases occurred globally, resulting in 429,000 deaths. Since 2000, malaria case incidence and mortality were reduced by 41% and 62%, respectively, mostly from the broad imple-mentation of malaria control interventions.2 Significant progress toward elimination has also been achieved, with 17 countries reaching elimination status between 2000 and 2015. In 2015, an additional 19 countries reported 1,000 or fewer indigenous cases, at least 10 of these being on track for elimination status by 2020.2However, many challenges to achieve and sustain elimination status remain,3not the least of which is preventing the highly efficient transmission of malaria parasites by mosquitoes.4The potential for
on-going transmission partly stems from the high proportion of submicroscopic infections that remain undetected in set-tings where malaria parasite transmission intensity is reduced.5,6 Current diagnostic techniques, such as light microscopy and rapid diagnostic tests (RDTs), do not have the sensitivity to detect all infections.7Molecular methods have been developed with increased sensitivity, but these methods remain to be implemented routinely within elimi-nation programs.8
Although there is sufficient evidence that submicroscopic infections contribute to malaria parasite transmission in some settings of intense malaria parasite transmission,9 this evidence is inconclusive in settings of lower endemicity.10–12 Mature, infectious gametocytes are present in the majority of symptomatic and asymptomatic malaria infections, often at low concentrations.13 Transmissibility or infectiousness to mosquitoes is increasingly appreciated as a complex phe-nomenon, related in a nonlinear manner to parasite density, varying independently of transmission intensity, and in flu-enced by human immune responses and vector sus-ceptibility to infection.6 Despite these issues, monitoring submicroscopic infections, particularly gametocytes, remains of central importance to broaden our understanding of trans-mission dynamics in low-endemic elimination settings. Pres-ently, there are few tools available to accomplish this goal, especially infield settings.
Molecular diagnostic tools such as nucleic acid tests provide the most accurate epidemiological data in all aspects of malaria control. In elimination settings, implementation of these tests for surveillance may support the prevention of reintroduction of malaria.8 For monitoring transmission potential, RNA-based testing shows particular promise, in-cluding reverse transcriptase polymerase chain reaction (RT-PCR),14quantitative nucleic acid sequence-based am-plification assay (QT-NASBA),15and RT-loop-mediated iso-thermal amplification (RT-LAMP)16methods. The targeting of sexual stage specific transcripts such as Pfs25,17,18 Pfs230,19and Pfg37720allows the detection of gametocytes at unsurpassed sensitivity. The sensitivities of these meth-ods are relatively high, reporting detection of Pfs25 at 20
* Address correspondence to Stephanie K. Yanow, University of Alberta, School of Public Health, Katz Group Centre 6032B, Edmonton, AB, CAN T6G 2E1. E-mail: yanow@ualberta.ca
gametocytes/mL for both QT-NASBA and RT-PCR detection of Pfs25.21,22One drawback is the need for nucleic acid purification prior to amplification, a step that is difficult to perform in thefield. For molecular diagnostics in general, the cost and complexity of these tests has precluded their use in low-resource settings.
We addressed these challenges in previous work by de-veloping a PCR test for malaria parasites that does not require nucleic acid purification23 and incorporated this test into a desiccated hydrogel matrix for use in a customized, portable real-time PCR machine.24In the present study, we describe the development of an RT-PCR method to detect gameto-cytes directly from small blood volumes in a one-tube assay. The reaction involves the addition of blood directly to a master mix, reverse transcription of template RNA in the blood to cDNA, followed by PCR amplification of the cDNA template. This reaction uses a commercial enzyme mixture for reverse transcription and PCR that is resistant to inhibitors in blood. The enzymes also tolerate a high concentration of SYBR Green DNA intercalating dye, which is necessary to generate sufficient fluorescence signal in the presence of blood. This assay was optimized to detect 18S rRNA on a conventional real-time PCR instrument and adapted for detection of a gene expressed in mature gametocytes (PF14_0367).25As a first step in showing the potential for this assay to detect game-tocytes in the field, we tested it on a blind panel of blood samples from gametocytemic individuals from Cameroon using a commercially available portable real-time PCR instrument.
METHODS
Parasite cultures and parasite dilution series. Plasmo-dium falciparum 3D7 strain MRA-102 was obtained from the Malaria Research and Reference Reagent Resource Center (BEI Resources, Manassas, VA) and grown in human eryth-rocytes in vitro at 3% hematocrit as described.26NF54
para-sites were maintained in vitro in a semiautomated culture system.27–29Briefly, parasites were grown in RPMI-1640 medium supplemented with human serum (complete medium) and 5% hematocrit (Sanquin) and medium was refreshed twice daily. Plasmodium asexual parasites at 10% density were syn-chronized by the selection of late trophozoites and schizonts on a 63% Percoll density gradient. This was followed by a 5% sorbitol treatment after 5 hours, killing the remaining schiz-onts. Five hours later, samples containing early ring-stage parasites were harvested. Gametocyte cultures were started
at 0.5% asexual parasitemia and treated with N-acetyl-glucosamine on day 7 to eliminate asexual parasites.30,31 Stage V parasites were obtained on day 14. The presence of asexual and sexual stage parasites was confirmed on Giemsa-stained slides, and parasite concentration was de-termined using a Burker-Turk cell counting chamber. Ten-fold serial dilutions of parasites were made in uninfected EDTA blood to be used directly as templates in amplification reac-tions. Nucleic acid was purified from the dilution series by MagNAPure LC Total Nucleic Acid Isolation Kit (Roche Mo-lecular Biochemicals, Mannheim, Germany). Extracted nucleic acid was treated with RQ1 DNase I (Promega, Madi-son, WI) for 30 minutes at 37°C to remove genomic DNA while keeping RNA intact. This purified RNA was used as template in amplification reactions.
Patient samples. Deidentified samples were used from a separate study on the transmissibility of P. falciparum infec-tions to Anopheles gambiae s.s. mosquitoes. All procedures used in that study were approved by the Cameroonian national ethical committee (2015/04/583/CE/CNERSH/SP) that monitored progress in annual reports. Caretakers of study participants provided written informed consent prior to inclusion in the study. Microscopically detectable gametocyte carriers aged 5–15 years were recruited from schools and communities surrounding Yaound ´e, Cameroon, as described previously.32Whole blood samples collected by venipuncture into heparinized tubes were stored directly at _80°C prior to use in the assay. Asexual and sexual stage densities were estimated in Giemsa-stained thick smears by counting para-site numbers per thousand white blood cells (WBCs), and converting to a density value assuming the standard of 8,000 WBC/μL of blood. For this cohort, values ranged from 8–1,496 gametocytes/μL of blood, with a median value of 80 gametocytes/μL and a standard deviation of 332 gametocytes/μL. From cohort members for whom ³ 1 mL of whole blood was remaining after transmissibility assess-ments, 1 mL blood samples were anonymized prior to ship-ment to Alberta, Canada. Participants gave explicit consent for their material to be analyzed outside Cameroon.
Direct RT-PCR assay. The direct RT-PCR was performed in a 25μL reaction containing 1× blood RT-PCR buffer, 0.5 μL RT polymerase mix (Direct Blood RT-PCR kit; VitaNavi Tech-nology, Manchester, MO), 40× SYBR Green (Thermo Fisher Scientific, Waltham, MA), 1 μL Ribolock RNase Inhibitor (Thermo Fisher Scientific), and primers at a final concentration of 200 nM, with the exception of the PFGEXP5 primers, which were used at afinal concentration of 400 nM (Table 1). A new 59
TABLE1
Primers used in this study
Target DNA sequence (59–39) Reference
18S rRNA forward GCCGTTTTTAGTTCGTGAAT This study
18S rRNA reverse GCAGGTTAAGATCTCGTTCG This study
Pf_A18S_fw TCCGATAACGAACGAGATCTTAAC 22
Pf_A18S_rev ATGTATAGTTACCTATGTTCAATTTCA 22
PF14_0367 forward GTTACATTTCGACCCAGCATAAATT 25
PF14_0367 reverse TCCCTGTGTTTTTGCTCATCTTC 25
PFE0065w forward GCAAAACAAGCCGTACATGTTG 25
PFE0065w reverse TTGCTAGGTAATATCCTTTTCTTTTTCC 25 PFGEXP5 forward GGGCTGTTATGTATATTTTTATTGAATTTT This study PFGEXP5 reverse CATTCGTTTCATTTTCACCACTTC This study
consensus primer was designed for 18S rRNA amplification; the 18S rRNA 39 consensus primer is a modified sequence from a previous study.33This primer set reduces nonspecific amplification that may originate from off-target primer in-teractions in the reverse transcription step. The blood com-ponent of the reaction mixture was added in a 2.5μL volume, either as uninfected blood controls, parasite serial dilutions in blood, or patient blood samples. In experiments where purified parasite RNA was tested, 2.5 mL purified RNA and 2.5μL uninfected blood were added to the reaction. Ther-mocycling was performed in both conventional and portable real-time PCR instruments. For the conventional instrument, reactions were run in 96-well PCR plates on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Labo-ratories, Inc., Hercules, CA) and in 200μL low profile PCR 8-strip tubes (BioRad) in the portable real-time PCR instrument (Open qPCR, Chai Biotechnologies Inc, Santa Clara, CA). The RT-PCR thermocycling program was as follows: 60°C reverse transcription for 30 minutes, 3 minute 95°C de-naturation, 45 cycles of 95°C for 20 seconds, 60°C for 30 seconds, 70°C for 30 seconds, 2 minute 70°C final extension, and melt curve analysis from 65°C to 95°C.
The 18S rRNA and PF14_0367 RT-PCR assays were per-formed in duplicate on patient samples in the clinical panel, in both the conventional and portable real-time PCR instru-ments. For 18S rRNA and PF14_0367 in the conventional instrument and 18S rRNA in the portable instrument, 1× enzyme concentration was used. Both 1× and 5× enzyme concentrations were compared for the initial optimization of PF14_0367 in the portable instrument and 5× enzyme con-centration was used to run the clinical samples on this instrument.
A two-step RT-PCR was performed as a reference standard for assessing the performance of the direct RT-PCR with samples from the clinical panel. In thefirst step, RNA was purified from patient blood samples as described earlier and reverse transcribed (High capacity cDNA Reverse Transcrip-tion Kit; Thermo Fisher Scientific). The resulting cDNA was used in the second step as template for quantitative PCR using the GoTaq qPCR master mix and Bryt Green dye (Promega) on the BioRad CFX instrument. Duplicate reactions were performed using primers targeting 18S rRNA (Pf_A18S fw and rev in Table 1) and PF14_0367 (Table 1). Thermocycling conditions included an initial denaturation of 95°C for 2 min-utes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute.
Data analysis. BioRad CFX Manager 3.1 software was used for conventional RT-PCR post-amplification data anal-ysis. Quantification cycle (Cq) determination mode was set to single threshold with baseline-subtracted curvefit and a user-defined threshold of 50 relative fluorescence units (RFUs) for analysis of parasite serial dilutions in blood. The limit of de-tection (LOD) of the assay was defined as the lowest parasite dilution that met the following criteria: 1) at least two of three curves crossing the threshold at or before the cycle cutoff value of 40 cycles for 18S rRNA and 45 cycles for all other targets; and 2) melting temperatures (Tm) within acceptable ranges as defined by positive controls for 18S rRNA (76–79°C) and PF14_0367 (77–80°C). The two-step RT-PCR reaction used as a reference standard in the clinical panel was analyzed in the same way with a user-defined threshold of 200 RFU. Melt curve analysis was not performed for this reaction.
For the portable real-time PCR instrument, Open qPCR software version 1.0.2 (Chai Biotechnologies Inc) was used for post-amplification analysis. Cq and Tm values were calcu-lated directly by the instrument software and reported. The software calculates Cq values for each individual curve by the second derivative maximum method, thus a single threshold is not used for all curves in the experiment (as in the commercial instrument). Raw data output from the software was used to generate amplification curves (baseline subtracted RFU versus PCR cycle) and melting curves (_d[RFU]/dT versus temperature) in Microsoft Excel (Microsoft Corporation, Red-mond, WA). The analytical sensitivity of the assay was defined as earlier, with a Cq cutoff of 45 and a Tm within acceptable ranges for 18S rRNA (76–80°C) and PF14_0367 (78–80°C). The clinical sensitivity and specificity of the direct RT-PCR assay for 18S rRNA and PF14_0367 transcripts on conven-tional and portable instruments were calculated in compar-ison to the reference standard RT-PCR. The concordance and kappa statistic were also determined for both assays between the conventional and portable instruments. For the comparison of sensitivities and specificities of the PF14_0367 assay on the two instruments, P values were calculated using McNemar’s exact test, and the proportion of agreement and 95% confidence intervals were reported (Supplemental Table 3).
RESULTS
Detection of parasite rRNA in a direct blood RT-PCR reaction. To optimize the direct RT-RT-PCR assay for de-tection of RNA targets in blood, we chose P. falciparum 18S small subunit rRNA, a commonly used target that we had studied previously with a direct-from-blood PCR diagnostic.23
For this target, there are 5–8 18S rRNA gene copies34and thousands of transcripts per cell.35In thefirst enzymatic step of this reaction, the ribosomal RNA is reverse transcribed into cDNA; in the second step, the 18S cDNA and 18S genomic DNA serve as templates for the PCR reaction. The LOD of this assay wasfirst evaluated for purified parasite RNA added to blood. RNA was purified from 10-fold dilutions of ring-stage parasites in uninfected blood, added to a new aliquot of un-infected blood and tested by direct RT-PCR (Figure 1A and B). The LOD was 10 parasites/mL blood, a value that exceeds the sensitivity of microscopy (10,000–100,000 parasites/mL).36 Next, we tested the LOD with intact ring-stage parasites se-rially diluted in uninfected blood and added directly to the reaction (Figure 1C and D). In this case, the LOD was 100 parasites/mL. The difference in sensitivity may reflect the in-creased availability of purified RNA compared with RNA re-leased from infected red blood cells. Raw data and statistical analysis of Cq values for the direct RT-PCR assay on the conventional real-time PCR instrument are presented in Supplemental Table 1.
Detection of mRNA by direct blood RT-PCR in asexual parasites. In the 18S rRNA RT-PCR assay, ampli-fication occurred from both rRNA and genomic DNA tar-gets. To determine whether the assay can strictly detect messenger RNA apart from the genomic DNA sequence, we selected PFE0065w skeleton-binding protein 1 mRNA, a target transcript expressed in ring-stage parasites.37 The LOD for this target was 1,000 parasites/mL (Figure 2A and B). The use of intron-spanning primers confirmed that the
reverse transcription step of the reaction was working, as these primers specifically amplify only RNA.25In addition,
we found that inclusion of RNase inhibitor was essential for high sensitivity detection of RNA. Omitting RNase inhibitor resulted in a decrease in signal for both purified RNA and parasites added directly to the reaction (Supplemental Figure 1).
MonitoringP. falciparum gene expression in gametocytes. Next, we tested the direct RT-PCR reaction on parasite sexual stage mRNA targets. These included sexual stage transcripts from P. falciparum gametocyte exported protein-5 (PFGEXPprotein-5)38 and PF14_0367.25PFGEXP5 is one of the earliest sexual stage markers identified to date, expressed in sexually committed ring-stage parasites, whereas PF14_0367 is a mature gametocyte marker of unknown function.25The LOD of the RT-PCR reaction for these targets in gameto-cytes serially diluted in blood was 1,000 parasites/mL (Figure 3). Although the assay has a similar sensitivity for both asexual- and sexual-stage mRNA targets, the am-plification curves cross the threshold at different cycles, reflecting the differences in the efficiencies of each primer set and the abundance of these mRNA species. The melt
curves for both PFGEXP5 and PF14_0367 also displayed some peaks that did not align with the major product peak, indicating the presence of nonspecific amplification with these primers, mostly at the lower parasite concentra-tions. Based on the relatively robust amplification of PF14_0367, we chose this as a candidate gametocyte marker for further study. To confirm that PF14_0367 was expressed only in gametocytes, we compared expression in purified asexual ring-stage parasites and mature stage V gametocytes, showing increased levels of expression in gametocytes (Figure 4). 18S rRNA expression, which is not expected to differ between sexual and asexual stages, was analyzed in parallel.
Performance of the direct blood RT-PCR assay on a portable real-time PCR instrument . To evaluate the po-tential of the direct RT-PCR assay to be used infield settings, we ran the assay on a portable 16-well real-time PCR machine (Open qPCR, Chai Biotechnologies, Inc). This instrument was chosen for its ability to generate real-time PCR data, ease of use, portability, and low cost. On this instrument, the RT-PCR assay had a LOD of 100 parasites/mL for 18S rRNA, similar to the conventional instrument, and 10,000 parasites/mL for
FIGURE1. Plasmodium falciparum 18S rRNA detection in blood by direct reverse transcriptase polymerase chain reaction (RT-PCR). (A)
Real-time amplification and (B) melting curves for 18S rRNA direct RT-PCR. Total nucleic acid was first purified from serial dilutions of P. falciparum 3D7 ring-stage parasites in uninfected blood. This purified nucleic acid was added back to blood in the direct RT-PCR reaction. (C) Amplification and (D) melting curves for 18S rRNA using the intact unpurified parasite serial dilutions in blood added directly to the reaction. The limit of detection for 18S rRNA from purified parasite nucleic acid is 10 parasites/mL and from unpurified parasite serial dilutions is 100 parasites/mL. These reactions were performed on a conventional real-time PCR instrument (Bio-Rad CFX Connect) with a threshold setting of 50 relativefluorescence units (horizontal line). Thisfigure appears in color at www.ajtmh.org.
PF14_0367, 10-fold less sensitive than the conventional in-strument (Figure 5). To boost the sensitivity of the reaction for PF14_0367, we increased the enzyme levels in the reaction 5-fold, achieving a LOD of 1,000 parasites/mL (Figure 5E). Raw data and statistical analysis of Cq values for the direct RT-PCR
assay on the portable real-time PCR instrument are presented in Supplemental Table 2.
The blood RT-PCR assay can successfully identify ga-metocytes in individuals from a high transmission setting. The ability to detect gametocytes in patient blood samples is a
FIGURE3. Detection of Plasmodium falciparum gametocyte mRNA targets in blood. (A) Real-time amplification and (B) melting curves for PF14_0367 mRNA direct reverse transcriptase polymerase chain reaction (RT-PCR). (C) Real-time amplification and (D) melting curves for PFGEXP5 mRNA direct RT-PCR. Both mRNA targets were detected in P. falciparum NF54 gametocyte serial dilutions on the conventional instrument at a limit of detection of 1,000 parasites/mL. Thisfigure appears in color at www.ajtmh.org.
FIGURE2. Detection of Plasmodium falciparum PFE0065w (SBP1) mRNA from asexual stages in blood. (A) Real-time amplification and (B) melting curves for PFE0065w mRNA direct reverse transcriptase polymerase chain reaction (RT-PCR) using P. falciparum 3D7 ring-stage serial dilutions in blood. The limit of detection for PFE0065w mRNA is 1,000 parasites/mL. This reaction was performed in the conventional real-time PCR instrument.
significant step toward developing a better diagnostic tool for malaria parasite transmission. A blind panel of 24 blood samples from individuals living in an area of high malaria parasite transmission in Cameroon was tested for 18S rRNA and PF14_0367 expression on conventional and portable real-time PCR instruments (Table 2). Each sample was tested in duplicate; Cq values were returned for all 96 runs in the conventional instrument and 93/96 runs in the portable in-strument (Table 2). Two runs generated no Cq values despite the presence of a curve and one run generated a low Cq value that was considered an instrument Cq calculation error based on examination of the amplification curve. Cq values for 18S rRNA expression suggest a significant parasite bur-den in the majority of patients. Negative controls showed no amplification for all targets and platforms. The sensitivity and specificity for 18S rRNA and PF14_0367 assays on both instruments were calculated in comparison to a standard two-step RT-PCR method (Table 3). This method uses RNA purified from the blood as a template and is considered a highly sensitive and specific assay for parasite transcripts. In both the conventional and portable instruments, the sensitivity and specificity for 18S rRNA was 100%, with 100% concordance between the two instruments. The sensitivity and specificity of the PF14_0367 assay on the conventional instrument were 85.7% and 70%, re-spectively. Many of the discrepant results were from sam-ples with low-target transcript levels. Three of 24 results were likely false positives, with two of these having Cq values greater than 39. Two of the 24 results were false negatives, with one of these (patient 21) having relatively low Cq values in the standard RT-PCR and low parasite densities by microscopy. The sensitivity and specificity of the PF14_0367 assay in the portable instrument were 78.6% and 90%, respectively. One of 24 results was likely a false positive, matching one of the false positives in the conventional instrument (patient 18). Three of 24 results were false negatives, with one matching a false negative in the conventional instrument (patient 21), and the others corresponding to samples that had relatively low Cq values in the standard RT-PCR. For the PF14_0367 assay, the
concordance between the two instruments was 79.2% (kappa = 0.583, 95% confidence interval [CI] = 0.269–0.898), with the discordant results observed in samples with low-target transcript levels. Comparing the sensitivities and specificities of the two assays revealed no significant dif-ference in the performance of the direct RT-PCR on the conventional or portable real-time PCR instruments (Sup-plemental Table 3).
DISCUSSION
The World Health Organization Global Technical Strategy for Malaria provides a 15-year framework for malaria elimi-nation that includes transforming malaria surveillance into a core intervention as one of its three strategic“pillars”.39For the goals of this strategy to be realized, highly sensitive field-friendly surveillance tools must be developed.40In this study,
we present a one-step RT-PCR assay that detected asexual malaria parasites with a LOD of 10 parasites/mL. This assay, if its sensitivity is confirmed in field settings, is markedly more sensitive than currently available microscopy and HRP2-based RDTs and has similar or higher sensitivity compared with a LAMP assay targeting P. falciparum mitochondrial tar-gets.41The high sensitivity for gametocyte-specific mRNA
directly from blood on a portable real-time PCR instrument indicates the tool may be highly relevant in monitoring malaria transmission potential. The assay is sensitive (1,000 parasites/mL) and specific for detection of mature gametocyte targets. Although lower sensitivities for game-tocytes have been reported with QT-NASBA (20 para-sites/mL)21and RT-LAMP (2 parasites/mL),16the advantage
of the RT-PCR method reported here is that it does not require nucleic acid purification and uses small volumes of blood (2.5mL). The RT-PCR method may lose some sen-sitivity because it is performed directly in the presence of blood, which can degrade the RNA target and inhibit polymerase activity.42,43This assay also has some variability in amplification and melt curve profiles for asexual- and sexual-stage transcripts emphasizing the need for optimi-zation of primer sets, reaction conditions, and enzyme
18S rRNA in:
Gametocytes
Ring stages
PF14_0367 in:
Gametocytes
Ring stages
FIGURE4. Detection of Plasmodium falciparum PF14_0367 mRNA and 18S rRNA in sexual- and asexual-stage parasites by direct RT-PCR.
Plasmodium falciparum strain NF54 stage V gametocytes and asexual ring stages purified 10 hours after merozoite invasion at 1 × 106 parasites/mL blood. Arrows indicate the amplification curves for 18S rRNA in gametocytes and ring stages (0.8 cycle shift), and Pf14_0367 (8.3 cycle shift).
concentration for each target. For simplicity of experimental design and interpretation of SYBR-based amplification and melting curves, internal controls were not used in this study. Nonetheless, the method presented here is sufficiently sen-sitive and robust in detecting gametocytes in blood samples on both a conventional real-time PCR instrument used in re-search laboratory settings and a commercially available por-table real-time PCR machine intended for use infield settings.
The choice of PF14_0367 as a gametocyte marker is sup-ported in this study in Figure 4, showing greatly increased expression in purified sexual compared with asexual stages. Detection of the PF14_0367 transcript at low levels in asexual stages most likely arises from contaminating sexual stages in the preparation, and is not expected to interfere with in-terpretation of the results.
1000 10000 100000 0 5 10 15 20 25 30 35 40 45 1000 10000 100000 0 5 10 15 20 25 30 35 40 45 0 2000 4000 6000 8000 10000 12000 14000 16000 60 65 70 75 80 85 90 95
18S rRNA
1X enzyme
PF14_0367
5X enzyme
0 2000 4000 6000 8000 10000 60 65 70 75 80 85 90 95 RFU RFU -d (RFU)/ dT -d(RFU)/ dTCycles Temperature, Celsius
Cycles Temperature, Celsius
1000 10000 100000 0 5 10 15 20 25 30 35 40 45 RFU Cycles 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 60 65 70 75 80 85 90 95 -d (R FU)/ dT Temperature, Celsius
PF14_0367
1X enzyme
A E F B C D 1 x 106 1 x 105 1 x 104 1 x 103 1 x 102 1 x 101 Parasites /mL blood Negative 1 x 106 1 x 105 1 x 104 1 x 103 1 x 102 1 x 101 Parasites /mL blood Negative 1 x 106 1 x 105 1 x 104 1 x 103 1 x 102 1 x 101 Parasites /mL blood NegativeFIGURE5. Detection of Plasmodium falciparum 18S rRNA and PF14_0367 mRNA in a portable real-time PCR instrument by direct RT-PCR.
Plasmodium falciparum RNA targets were tested in a 16-well portable real-time PCR instrument. Amplification (A, C, and E) and melt curve (B, D, and F) data from the instrument are shown. For the18S rRNA assay, standard (1×) concentration of enzyme was used, and produced a LOD of 100 parasites/mL (A and B). For the PF14_0367 assay, mRNA was detected in 3D7 gametocytes at a LOD of 10,000 parasites/mL with 1× concentration of enzyme (C and D) or 1,000 parasites/mL with 5× concentration of enzyme (E and F). Individual Cq values obtained directly from the instrument are listed in Supplemental Table 2. Thisfigure appears in color at www.ajtmh.org.
The performance of the RT-PCR assay onfield samples from a region of high transmission in Cameroon indicates it will be valuable as a transmission surveillance tool. To assess the performance of this test, results were compared with an RT-PCR reference standard using purified RNA from the panel as template. The clinical sensitivity and specificity of this test for malaria detection were excellent in both conventional and portable instruments. With regard to monitoring gametocyte transcripts in clinical samples, the assay performance was also promising, considering
the relatively low levels of transcripts compared with 18S rRNA. To reliably detect the lower levels of PF14_0367 transcripts, the assay performed in the portable instrument required increased enzyme compared with the 18S rRNA assay. The sensitivities of the conventional and portable PF14_0367 assays based on comparison to the reference standard (85.7% versus 78.6%) were not significantly dif-ferent, which was not unexpected considering the small sample size. False negatives in both instruments tended to correspond to samples with relatively high Cq values,
TABLE2
Direct RT-PCR detection of 18SrRNA and PF14_0367 gametocyte mRNA in individuals from a high malaria transmission setting in Cameroon
18S rRNA RT-PCR PF14_0367 RT-PCR
Conventional Portable Ref§ Conventional Portable Ref
Patient* Cq† Tm (°C)‡ Cq Tm (°C) Cq Cq Tm (°C) Cq Tm (°C) Cq 1 17.9 77 18 78.5 16.7 33.4 78.5 31.9 79.2 39.4 18 76.5 20 79.1 16.7 32.7 78 32.4 79.6 38.2 2 14.4 77.5 16.8 79.3 17.8 32.1 78.5 33 79.8 35.7 14.3 77.5 16.5 79.1 17.8 32.1 78.5 32.9 80 34.7 3 20.6 77.5 27 78.9 22.8 36.2 79 36.2 79.7 31.7 21.2 77.5 26.8 79.8 22.8 35.5 79 36 79.6 32 4 26.3 76.5 31.1 79.1 29.5 – – – – – 26.4 77 NC – 29.5 – – – – – 5 17.4 77 18.5 78 14.4 33.7 78.5 31.3 78.8 27.3 17.3 77 19.4 78.4 14.4 33.1 78 30.8 79 26.7 6 25.4 77 31.9 79.3 25.6 – – – – – 26.1 77.5 33.5 79.8 25.6 – – – – – 7 20.1 77 24.9 78.3 14.1 38.9 78.5 – – 29.4 19.8 76.5 24.6 79.5 14.3 39 78.5 – – 29.1 8 16.2 76.5 19.6 77.8 15.6 34.7 77.5 33 78.8 33.2 16.2 76.5 18.6 78.1 15.6 34.1 77.5 33.9 79.4 34.1 9 21.3 76 NC 76.4 24.9 39.3 77.5 39.6 78.3 35.8 21.3 76 22.3 76.8 24.9 40.1 78.5 39.9 78.8 – 10 18.3 77 25.2 77 17.7 38.7 78 – – – 17.7 76.5 22.9 78.1 17.7 37.9 79 – – – 11 – – – – – – – – – – – – – – – – – – – – 12 21.4 77.5 26.2 79 20.7 36.1 79 37.3 79.2 35.3 21.4 77.5 26.5 78.7 20.8 36.2 79 38.4 79.1 34.5 13 – – – – – – – – – – – – – – – – – – – – 14 26.5 76.5 29.6 79 27.1 – – – – – 26.2 77 29.6 78.7 27.2 – – – – – 15 18.3 77 19.1 78 16.4 32.3 78 31 79 24.7 18 77 19.8 78.6 16.4 32.5 78 31.1 79.3 25.6 16 21 77.5 28.7 78.5 19.5 – – – – – 21.5 77.5 29 78.9 19.5 41.8 78.5 – – – 17 20 77 23.7 78.1 18.5 34.9 79 33.9 79.3 32.1 19.7 77 26.1 78.5 18.6 34.3 78.5 30.6 78.6 30.8 18 17.4 77 22.8 78.3 16.8 40.2 78 38.6 79.7 – 17.3 76.5 25.8 78.3 16.9 39.5 78.5 40.4 79.7 – 19 – – – – – – – – – – – – – – – – – – – – 20 21.7 76.5 27.1 79.5 22.4 41.5 79 – – – 21.6 77 25.4 79.5 22.5 39.9 79 – – – 21 28.6 77 35.9 79 27.8 – – – – 28.4 28.4 77.5 NC – 27.5 – – – – 29.5 22 18.2 76 24.2 78.7 20.2 38.5 77 39.4 79 36.1 18.5 76.5 23.5 79.2 20.2 37.8 78 39 79.1 35.6 23 – – – – – – – – – – – – – – – – – – – – 24 23.4 76.5 29.9 79 22.6 – – 40 79.1 40.1 23.3 77 29 80.2 22.6 – – 42.1 78.9 –
Cq = quantification cycle; RT-PCR = reverse transcriptase polymerase chain reaction; Tm = melting temperature. * Duplicate reactions performed for each patient sample are shown.
† Quantification cycle value. Negative is indicated as –, judged by cutoff values for each target and instrument. NC indicates (1) no amplification curve but Cq value was assigned, or (2) presence of an amplification curve with no Cq value assigned; both considered negative.
‡ Melting temperature. Negative (–) indicates no value assigned by the instrument. § Reference standard RT-PCR.
suggesting these may have been low transcript samples on the cusp of detection, or samples containing reaction in-hibitors. Much the same can be said for the specificities of the PF14_0367 assay in the portable and conventional in-struments (90% versus 70%), which were also not signi fi-cantly different and tended to occur in samples with high Cq values. It is possible that the test performance has been af-fected by the potential for single-stranded RNA target to be degraded, especially in low transcript samples. Taken to-gether, these results show much promise for the further de-velopment of a direct RT-PCR assay. Future studies with an expanded cohort of patients of varying levels of parasitemia, including asymptomatic and submicroscopic patients, will clarify these issues.
The portable instrument is a rugged, easily transportable, AC-powered unit that performs 16 reactions per run in-cluding controls. It is capable of onboard Cq and melting curve processing and results display, avoiding the need for a computer to run the instrument. Issues with venipuncture may be overcome byfingerprick collection of blood, as the RT-PCR assay runs on small sample volumes. However, to enable implementation in thefield, several challenges remain to be addressed. Samples currently require cold storage to preserve the RNA target, as do the liquid components of the RT-PCR assay. In a previous study, we adapted PCR diagnostics for thefield using desiccated hydrogels24that
preserve enzyme activity at room temperature. For that assay, samples could be added directly after collection to desiccated hydrogels and run on the portable real-time PCR instrument. We envision a similar approach for the RT-PCR assay, which would be particularly effective in avoiding degradation of the RNA template. The relatively low throughput of the instrument may still require some cold storage of samples in larger studies; however, the low cost may make it possible to have multiple in-struments running at once. The detection of RNA tar-gets present in low abundance, as was the case with PF14_0367, may also require increased enzyme and modified master mix formulations, increasing the cost of the assay in some cases. Despite these challenges, the success of the direct RT-PCR on the portable real-time PCR instrument coupled with the previous success of the hydrogel assay provides a clear path for further testing in thefield.
The detection of gametocytes by sensitive molecular methods may be particularly relevant for epidemiological studies examining the human infectious reservoir and assessing the efficacy of transmission-interrupting regi-mens.6Detection of gametocytes at sensitivities below the
threshold of microscopy, coupled with mosquito feeding assays, may shed new light on infectiousness in many areas of study such as age-stratified populations, in longitudinal studies measuring duration of infectiousness, and in
regions of low parasite density targeted by malaria elimi-nation programs. Similarly, it is expected that sensitive tools for gametocyte detection will be useful to measure the efficacy of transmission-blocking vaccines currently in preclinical development and expected to enter clinical testing in the next 5 years.44
CONCLUSION
The shift in focus from malaria control to elimination programs requires a change in strategy that is underscored by the need for more sensitive surveillance tools. The de-velopment of molecular tests, particularly those of high sensitivity and versatility to detect not only the presence of malaria parasites, but other important characteristics such as transmission potential, will be of great value in sustaining elimination efforts and preventing reintroduction of dis-ease. The use of simple, RNA-based diagnostics such as the direct RT-PCR assay described here, addresses many of the specific needs of countries on the path to malaria eradication.
Received January 16, 2017. Accepted for publication April 6, 2017. Published online May 30, 2017.
Note: Supplementalfigure and tables appear at www.ajtmh.org. Acknowledgments: We would like to thank Walter Gordy and Irina Dinu for assistance in data analysis and the Cameroonfield team and patients for providing samples. We are also thankful for Plas-modium falciparum 3D7, MRA-102, deposited by DJ Carucci, obtained through the MR4 as part of the BEI Resources Repository, NIAID, NIH.
Financial support: This study was funded by PATH and by a grant from Alberta Economic Development and Trade co-funded by Aquila Di-agnostic Systems, Inc (Edmonton, Canada). Sanna R. Rijpma and Teun Bousema are further supported by a VIDI fellowship from the Netherlands Organization for Scientific Research (NWO; project number 016.158.306).
Conflict of interest: Stephanie K. Yanow is a member of the Scientific Advisor Board of Aquila Diagnostic Systems, Inc.
Authors’ addresses: Brian J. Taylor, School of Public Health, Katz Group Centre 6043, University of Alberta, Edmonton, Alberta, Can-ada, E-mail: bjtaylor@ualberta.ca. Kjerstin Lanke and Teun Bousema, Department of Medical Microbiology, Radboud University Medical Center, Nijmegen, NL, E-mails: kjerstin.lanke@radboudumn.nl and teun.bousema@radboudumc.nl. Shanna L. Banman, School of Public Health, University of Alberta, Edmonton, Alberta, Canada, E-mail: sbanman@ualberta.ca. Isabelle Morlais, Institut de Recherche pour le D ´eveloppement, Universit ´e de Montpellier, MIVEGEC, Montpellier, Languedoc-Roussillon, France, and Laboratoire de Recherche sur le Paludisme, Organisation de Coordination pour la lutte contre les End ´emies en Afrique centrale, Yaound ´e, Cameroon, E-mail: isabelle. morlais@ird.fr. Merribeth J. Morin, PATH Malaria Vaccine Initiative, Washington, DC, E-mail: mmorin@path.org. Sanna R. Rijpma, De-partment of Pharmacology and Toxicology, Radboud University Medical Center, Nijmegen, Gelderland, NL, E-mail: sanna.rijpma@ radboudumc.nl. Stephanie K. Yanow, School of Public Health, Katz TABLE3
Clinical sensitivity and specificity of 18S rRNA and PF14_0367 RT-PCR assays performed in conventional and portable real-time PCR instruments
Target Instrument Sensitivity (%) 95% CI Specificity (%) 95% CI
18S rRNA Conventional 100.0 83.2–100.0 100.0 39.8–100.0 18S rRNA Portable 100.0 83.2–100.0 100.0 39.8–100.0 PF14_0367 Conventional 85.7 57.2–98.2 70.0 34.8–93.3 PF14_0367 Portable 78.6 49.2–95.3 90.0 55.6–99.8
Group Centre 6032B, University of Alberta, Edmonton, Alberta, Can-ada, and Department of Medical Microbiology and Immunology, Katz Group Centre, University of Alberta, Edmonton, Alberta, Canada, E-mail: yanow@ualberta.ca.
REFERENCES
1. Mendis K, Rietveld A, Warsame M, Bosman A, Greenwood B, Wernsdorfer WH, 2009. From malaria control to eradi-cation: the WHO perspective. Trop Med Int Health 14: 802–809.
2. World Health Organization, 2016. World Health Organization: World Malaria Report. Geneva, Switzerland: World Health Organization.
3. Alonso PL, et al., 2011. A research agenda to underpin malaria eradication. PLoS Med 8: e1000406.
4. Churcher TS, Trape JF, Cohuet A, 2015. Human-to-mosquito transmission efficiency increases as malaria is controlled. Nat Commun 6: 6054.
5. Okell LC, Bousema T, Griffin JT, Ouédraogo AL, Ghani AC, Drakeley CJ, 2012. Factors determining the occurrence of sub-microscopic malaria infections and their relevance for control. Nat Commun 3: 1237.
6. Bousema T, Okell LC, Felger I, Drakeley C, 2014. Asymptomatic malaria infections: detectability, transmissibility and public health relevance. Nat Rev Microbiol 12: 833–40.
7. Mwingira F, Genton B, Kabanywanyi AN, Felger I, 2014. Comparison of detection methods to estimate asexual Plasmodium falciparum parasite prevalence and gameto-cyte carriage in a community survey in Tanzania. Malar J 13: 433.
8. Britton S, Cheng Q, McCarthy JS, 2016. Novel molecular di-agnostic tools for malaria elimination: a review of options from the point of view of high-throughput and applicability in re-source limited settings. Malar J 15: 88.
9. Slater HC, et al., 2015. Assessing the impact of next-generation rapid diagnostic tests on Plasmodium falciparum malaria elimination strategies. Nature 528: S94–S101.
10. Goncalves BP, Drakeley C, Bousema T, 2016. Infectivity of microscopic and submicroscopic malaria parasite infec-tions in areas of low malaria endemicity. J Infect Dis 213: 1516–1517.
11. Lin JT, et al., 2015. Microscopic Plasmodium falciparum game-tocytemia and infectivity to mosquitoes in Cambodia. J Infect Dis 213: 1491–1494.
12. Stone W, Goncalves BP, Bousema T, Drakeley C, 2015. Assessing the infectious reservoir of falciparum malaria: past and future. Trends Parasitol 31: 287–296.
13. Bousema T, Drakeley C, 2011. Epidemiology and infectivity of Plasmodium falciparum and Plasmodium vivax gametocytes in relation to malaria control and elimination. Clin Microbiol Rev 24: 377–410.
14. Babiker HA, Schneider P, Reece SE, 2008. Gametocytes: insights gained during a decade of molecular monitoring. Trends Par-asitol 24: 525–530.
15. Schneider P, Schoone G, Schallig H, Verhage D, Telgt D, Eling W, Sauerwein R, 2004. Quantification of Plasmodium falciparum gametocytes in differential stages of development by quanti-tative nucleic acid sequence-based amplification. Mol Bio-chem Parasitol 137: 35–41.
16. Buates S, Bantuchai S, Sattabongkot J, Han ET, Tsuboi T, Udomsangpetch R, Sirichaisinthop J, Tan-ariya P, 2010. Development of a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) for clinical detection of Plasmodium falciparum gametocytes. Parasitol Int 59: 414–420.
17. Babiker HA, Abdel-Wahab A, Ahmed S, Suleiman S, Ranford-Cartwright L, Carter R, Walliker D, 1999. Detection of low level Plasmodium falciparum gametocytes using reverse transcrip-tase polymerase chain reaction. Mol Biochem Parasitol 99: 143–148.
18. Koepfli C, et al., 2015. Blood-stage parasitaemia and age de-termine Plasmodium falciparum and P. vivax gametocytaemia in Papua New Guinea. PLoS One 10: e0126747.
19. Wampfler R, Timinao L, Beck HP, Soulama I, Tiono AB, Siba P, Mueller I, Felger I, 2014. Novel genotyping tools for investigating transmission dynamics of Plasmodium falciparum. J Infect Dis 210: 1188–1197.
20. Alano P, et al., 1995. COS cell expression cloning of Pfg377, a Plasmodium falciparum gametocyte antigen associated with osmiophilic bodies. Mol Biochem Parasitol 74: 143–156.
21. Schneider P, Wolters L, Schoone G, Schallig H, Sillekens P, Hermsen R, Sauerwein R, 2005. Real-time nucleic acid sequence-based amplification is more convenient than real-time PCR for quantification of Plasmodium falciparum. J Clin Microbiol 43: 402–405.
22. Wampfler R, Mwingira F, Javati S, Robinson L, Betuela I, Siba P, Beck HP, Mueller I, Felger I, 2013. Strategies for de-tection of Plasmodium species gametocytes. PLoS One 8: e76316.
23. Taylor BJ, Martin KA, Arango E, Agudelo OM, Maestre A, Yanow SK, 2011. Real-time PCR detection of Plasmodium directly from whole blood andfilter paper samples. Malar J 10: 244.
24. Taylor BJ, et al., 2014. A lab-on-chip for malaria diagnosis and surveillance. Malar J 13: 179.
25. Joice R, et al., 2013. Inferring developmental stage composition from gene expression in human malaria. PLOS Comput Biol 9: e1003392.
26. Trager W, Jensen JB, 1976. Human malaria parasites in contin-uous culture. Science 193: 673–675.
27. Ifediba T, Vanderberg JP, 1981. Complete in vitro maturation of Plasmodium falciparum gametocytes. Nature 294: 364–366.
28. Ponnudurai T, Lensen AH, Leeuwenberg AD, Meuwissen JH, 1982. Cultivation of fertile Plasmodium falciparum gameto-cytes in semi-automated systems. 1. Static cultures. Trans R Soc Trop Med Hyg 76: 812–818.
29. Ponnudurai T, Lensen AH, Van Gemert GJ, Bensink MP, Bolmer M, Meuwissen JH, 1989. Infectivity of cultured Plasmodium falciparum gametocytes to mosquitoes. Parasitology 98: 165–173.
30. Ponnudurai T, Lensen AH, Meis JF, Meuwissen JH, 1986. Syn-chronization of Plasmodium falciparum gametocytes using an automated suspension culture system. Parasitology 93: 263–274.
31. van Schaijk BC, et al., 2008. Gene disruption of Plasmodium fal-ciparum p52 results in attenuation of malaria liver stage de-velopment in cultured primary human hepatocytes. PLoS One 3: e3549.
32. Sandeu MM, Abate L, Tchioffo MT, Bayibéki AN, Awono-Ambéné PH, Nsango SE, Chesnais CB, Dinglasan RR, de Meeûs T, Morlais I, 2016. Impact of exposure to mosquito transmission-blocking antibodies on Plasmodium falcipa-rum population genetic structure. Infect Genet Evol 45: 138–144.
33. Kamau E, Tolbert LS, Kortepeter L, Pratt M, Nyakoe N, Muringo L, Ogutu B, Waitumbi JN, Ockenhouse CF, 2011. Development of a highly sensitive genus-specific quantitative reverse tran-scriptase real-time PCR assay for detection and quantitation of Plasmodium by amplifying RNA and DNA of the 18S rRNA genes. J Clin Microbiol 49: 2946–2953.
34. Mercereau-Puijalon O, Barale JC, Bischoff E, 2002. Three multi-gene families in Plasmodium parasites: facts and questions. Int J Parasitol 32: 1323–1344.
35. Murphy SC, et al., 2012. Real-time quantitative reverse tran-scription PCR for monitoring of blood-stage Plasmodium fal-ciparum infections in malaria human challenge trials. Am J Trop Med Hyg 86: 383–394.
36. Wongsrichanalai C, Barcus MJ, Muth S, Sutamihardja A, Wernsdorfer WH, 2007. A review of malaria diagnostic tools: microscopy and rapid diagnostic test (RDT). Am J Trop Med Hyg 77: 119–127.
37. Blisnick T, Morales Betoulle ME, Barale JC, Uzureau P, Berry L, Desroses S, Fujioka H, Mattei D, Braun Breton C, 2000. Pfsbp1, a Maurer’s cleft Plasmodium falciparum protein, is associated with the erythrocyte skeleton. Mol Biochem Parasitol 111: 107–121.
38. Tiburcio M, Dixon MW, Looker O, Younis SY, Tilley L, Alano P, 2015. Specific expression and export of the Plasmodium fal-ciparum Gametocyte EXported Protein-5 marks the gameto-cyte ring stage. Malar J 14: 334.
39. World Health Organization, 2015. Global Technical Strategy for Malaria 2016–2030. Geneva, Switzerland: World Health Organization. 40. Malaria Policy Advisory Committee, 2014. WHO Evidence Review
Group on Malaria Diagnosis in Low Transmission Settings. Geneva, Switzerland: World Health Organization.
41. Hopkins H, et al., 2013. Highly sensitive detection of malaria parasitemia in a malaria-endemic setting: performance of a new
loop-mediated isothermal amplification kit in a remote clinic in Uganda. J Infect Dis 208: 645–652.
42. Tsui NB, Ng EK, Lo YM, 2002. Stability of endogenous and added RNA in blood specimens, serum, and plasma. Clin Chem 48: 1647–1653.
43. Al-Soud WA, Radstrom P, 2001. Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 39: 485–493.
44. Nikolaeva D, Draper SJ, Biswas S, 2015. Toward the development of effective transmission-blocking vaccines for malaria. Expert Rev Vaccines 14: 653–680.