VIALE, Beatrice, et al.

Article

Reference

Transient deregulation of canonical Wnt signaling in developing pyramidal neurons leads to dendritic defects and impaired behavior

VIALE, Beatrice, et al.

Abstract

During development, the precise implementation of molecular programs is a key determinant of proper dendritic development. Here, we demonstrate that canonical Wnt signaling is active in dendritic bundle-forming layer II pyramidal neurons of the rat retrosplenial cortex during dendritic branching and spine formation. Transient downregulation of canonical Wnt transcriptional activity during the early postnatal period irreversibly reduces dendritic arbor architecture, leading to long-lasting deficits in spatial exploration and/or navigation and spatial memory in the adult. During the late phase of dendritogenesis, canonical Wnt-dependent transcription regulates spine formation and maturation. We identify neurotrophin-3 as canonical Wnt target gene in regulating dendritogenesis. Our findings demonstrate how temporary imbalance in canonical Wnt signaling during specific time windows can result in irreversible dendritic defects, leading to abnormal behavior in the adult.

VIALE, Beatrice, et al . Transient deregulation of canonical Wnt signaling in developing

pyramidal neurons leads to dendritic defects and impaired behavior. Cell Reports , 2019, vol.

27, no. 5, p. 1487-1502.e6

PMID : 31042475

DOI : 10.1016/j.celrep.2019.04.026

Available at:

http://archive-ouverte.unige.ch/unige:126064

Disclaimer: layout of this document may differ from the published version.

Article

Transient Deregulation of Canonical Wnt Signaling in Developing Pyramidal Neurons Leads to Dendritic Defects and Impaired Behavior

Graphical Abstract

Highlights

d

Cortical neurons express high canonical Wnt signaling throughout dendritogenesis

d

Temporary Wnt downregulation reduces dendritic complexity and spine number

d

Canonical Wnt signaling regulates dendritogenesis through neurotrophin-3 expression

d

Dendritic defects are irreversible and lead to abnormal behavior in adult rats

Authors

Beatrice Viale, Lin Song,

Volodymyr Petrenko, ..., Lijia An, Laszlo Vutskits, Jozsef Zoltan Kiss

Correspondence

[email protected]

In Brief

Viale et al. demonstrate that transient downregulation of canonical Wnt signaling transcriptional activity during early postnatal period leads to

irreversible decrease in dendritic complexity and spine number. These long-term defects result in abnormal behavior in the adult rats. In the late phase, reduction in Wnt signaling affects only spine number.

Viale et al., 2019, Cell Reports27, 1487–1502 April 30, 2019ª2019 The Authors.

https://doi.org/10.1016/j.celrep.2019.04.026

Cell Reports

Article

Transient Deregulation of Canonical Wnt Signaling in Developing Pyramidal Neurons Leads to

Dendritic Defects and Impaired Behavior

Beatrice Viale,^1,5Lin Song,^1,2,5Volodymyr Petrenko,¹Anne-Laure Wenger Combremont,¹Alessandro Contestabile,¹ Riccardo Bocchi,^1,4Patrick Salmon,¹Alan Carleton,¹Lijia An,²Laszlo Vutskits,^1,3and Jozsef Zoltan Kiss^1,6,*

1Department of Basic Neurosciences, University of Geneva Medical School, 1211 Geneva 4, Switzerland

2School of Life Science and Biotechnology, Dalian University of Technology, Dalian, Liaoning 116024, China

3Department of Anesthesiology, Pharmacology and Intensive Care, University Hospitals of Geneva, 1211 Geneva 4, Switzerland

4Present address: Department of Physiological Genomics, Ludwig Maximilians University, 82152 Martinried-Planegg, Germany

5These authors contributed equally

6Lead Contact

*Correspondence:[email protected] https://doi.org/10.1016/j.celrep.2019.04.026

SUMMARY

During development, the precise implementation of molecular programs is a key determinant of proper dendritic development. Here, we demonstrate that canonical Wnt signaling is active in dendritic bundle-forming layer II pyramidal neurons of the rat retrosplenial cortex during dendritic branching and spine formation. Transient downregulation of canon- ical Wnt transcriptional activity during the early post- natal period irreversibly reduces dendritic arbor architecture, leading to long-lasting deficits in spatial exploration and/or navigation and spatial memory in the adult. During the late phase of dendritogenesis, canonical Wnt-dependent transcription regulates spine formation and maturation. We identify neuro- trophin-3 as canonical Wnt target gene in regulating dendritogenesis. Our findings demonstrate how tem- porary imbalance in canonical Wnt signaling during specific time windows can result in irreversible den- dritic defects, leading to abnormal behavior in the adult.

INTRODUCTION

The shape and complexity of dendritic arbor are essential for processing and integration of information in the neural circuit and represent a hallmark of neuronal subtypes (Whitford et al., 2002). Abnormal dendritic development of cortical neurons can lead to severe neurodevelopmental disorders such as intellec- tual disability, autism, and schizophrenia (Kaufmann and Moser 2000; Kulkarni and Firestein 2012). Therefore, unraveling the mechanisms and the regulation of dendritic morphogenesis is crucial to understand how alterations in this process might contribute to neurodevelopmental disorders. The proper devel- opment of dendrites relies on a multitude of intrinsic and extrinsic factors, including transcription factors, cell adhesion molecules, cytoskeletal regulators, secreted factors, and neuronal activity

(Arikkath 2012; Lefebvre et al., 2015; Zhang et al., 2012; Call- away and Borrell 2011). Despite the large number of identified regulatory factors, our understanding of this process is still incomplete.

Wnt proteins are widely expressed in the cerebral cortex during embryonic and postnatal development (Grove et al., 1998; Shimogori et al., 2004). In early corticogenesis, evolu- tionary conserved canonical Wnt-b-catenin signaling regu- lates the proliferation of neural progenitor cells, neuronal differentiation (Chenn and Walsh 2002; Woodhead et al., 2006; Hirabayashi et al., 2004), and radial migration of up- per-layer neurons (Boitard et al., 2015; Bocchi et al., 2017).

On the other hand, non-canonical Wnt pathways appear to be critical for axon specification, growth, and guidance (Zhang et al., 2007; Clark et al., 2014; Keeble et al., 2006; Li et al., 2009) and have been shown to regulate dendritic and synaptic formation (Rosso et al., 2005; Hagiwara et al., 2014; Okerlund et al., 2016; Chen et al., 2017; Nagaoka et al., 2014; Ciani et al., 2011; Lanoue et al., 2017). Although in vitro studies have implicated the canonical Wnt-b-catenin pathway in dendritic growth of hippocampal neurons (Yu and Malenka 2003) and of spinal cord neural precursors (Da- vid et al., 2010), the direct impact of this signaling on dendritic morphogenesisin vivo, in the context of cortical development, remains unknown.

Here, we tested the hypothesis that canonical Wnt signaling through a transcription-dependent mechanism is involved in dendritic morphogenesis of dendritic bundle-forming layer II py- ramidal neurons of the rat retrosplenial cortexin vivo. The retro- splenial cortex (RSC) is part of the dorso-medial limbic cortex, which is a particularly rich source of Wnt ligands (Grove et al., 1998; Shimogori et al., 2004). The RSC plays a central role in the integration of sensory and motor information with limbic sys- tem functions and has been implicated in spatial navigation and memory (Czajkowski et al., 2014; Alexander and Nitz 2015;

Burles et al., 2017). A characteristic feature of the RSC is the presence of dendritic bundles in layer I, formed by the apical dendrites of layer II callosal projection neurons (Ichinohe et al., 2003; Miro´-Bernie´ et al., 2006). These late-born excitatory neurons originate in the dorso-medial aspect of the ventricular

A

C

D

E

B

(legend on next page)

and subventricular zones and migrate radially by gliophilic loco- motion (Zgraggen et al., 2012). Here we report that canonical Wnt-dependent transcriptional activity regulates the dendritic arbor development of these neurons. We identified neurotro- phin-3 (NT3) as a downstream target of canonical Wnt pathway.

Importantly, dendritic defects caused by early transient Wnt downregulation led to spatial navigation and spatial memory def- icits in the adult. Together, these results reveal a role for canon- ical Wnt transcriptional activity in dendritic development of layer II pyramidal neuronsin vivo.

RESULTS

Canonical Wnt Signaling Is Active in Layer II Pyramidal Neurons of the RSC and Regulates Dendritogenesis To investigate whether canonical Wnt signaling plays a role in dendritogenesis, we first examined if this signaling is active in layer II RSC pyramidal neurons. We introduced a well-character- ized canonical Wnt activity reporter (Boitard et al., 2015; Bocchi et al., 2017), TOPdGFP, in layer II neurons throughin uteroelec- troporation at embryonic day (E) 18, together with a red fluores- cent protein-expressing plasmid (TOM) that served as internal control. Large-field confocal images of coronal slices at post- natal day (P) 0 revealed high expression of TOPdGFP in layer II neurons, after the end of radial migration (Figure 1A). We found that at P0 a significantly higher percentage of TOPdGFP-TOM- double-positive neurons is present in layer II compared with the migrating population (Figure 1B). Hence, canonical Wnt signaling is active in layer II pyramidal cells during the postnatal period.

To study the role of canonical Wnt signaling in dendritic development, we performed loss-of-function (LOF) and gain- of-function (GOF) experiments. To specifically downregulate the transcriptional activity of canonical Wnt signaling, we took advantage of a previously described dominant-negative form of the Wnt effector T cell factor T cell factor 4 (dnTCF4) (Korinek et al., 1997; Bocchi et al., 2017). For GOF experiments, we overexpressed a stabilized form of b-catenin (Amit et al., 2002; Boitard et al., 2015). The expression of the gene of inter- est (GOI) was under the control of the doxycycline-inducible TET-responsive promoter pTF (Giry-Laterrie`re et al., 2011).

We introduced these plasmids in layer II pyramidal neurons of RSC by in utero electroporation at E18 and induced GOI expression by doxycycline (dox) administration from E21 to P21 (i.e., during the peak period of dendritic development) (Fig- ure 1C;Figure S1A). To obtain single-cell resolution of dendritic arborization among bundles, we iontophoretically injected single cells with Lucifer yellow (LY) on fixed coronal slices (Figure 1C;Figure S1A) (Briner et al., 2010). Neurolucida recon- structions of injected layer II neurons revealed that dnTCF4- expressing cells displayed reduced dendritic arborization compared with control cells at P21 (Figure 1C), while Wnt upre- gulation by b-catenin overexpression resulted in increased dendritic complexity (Figure S1A). Statistical analyses revealed a decreased dendritic length and smaller number of branch- points in both apical and basal dendrites of dnTCF4 neurons compared with control (Figure 1D). In contrast, b-catenin overexpression led to increases of all parameters analyzed (Figure S1B). Furthermore, we found that dnTCF4-expressing neurons displayed a smaller number of high-order branches compared with control (Figure 1E). On the other hand,b-catenin led to an increase in number of high-order branches (Figure S1C).

To further confirm the specificity of the LOF phenotype, we overexpressed a dominant-negative form of the intermediate component of the signaling, dishevelled-2, that lacks the DIX domain (DDVL2). This mutant form is unable to transduce canon- ical Wnt signaling (Bocchi et al., 2017). We found thatDDVL2- transfected neurons exhibited reduced dendritic arborization, similar to dnTCF4 (Figures S1D and S1E).

Given that several components of the Wnt pathway are ex- pressed in major subdivisions of the postnatal cerebral cortex (Shimogori et al., 2004), we tested whether canonical Wnt LOF could induce dendritic defects in layer II and III pyramidal neu- rons of the somatosensory cortex (S1). We found substantial de- creases in apical and basal dendritic length and number of branchpoints in dnTCF4 neurons of S1 (Figures S1F and S1G).

Thus, the involvement of canonical Wnt signaling in dendritic branching seems to be a general phenomenon in the neocortex.

Overall, these data support the hypothesis that the transcrip- tion-dependent effects of canonical Wnt signaling are necessary for proper dendritic development.

Figure 1. Canonical Wnt Signaling Is Required for Dendritic Development of Layer II Pyramidal Neurons

(A) Timeline of the experiment and plasmids used. Coronal slices of P0 brains electroporated at E18 with tomato (TOM) and TOPdGFP (GFP) showing low level of canonical Wnt activity in migrating neurons (arrows) and high canonical Wnt activity in layer II neurons (arrowheads). CP, cortical plate; IZ, intermediate zone; L2, layer II; VZ, ventricular zone.

(B) Quantification of TOPdGFP⁺cells within TOM⁺population. Histograms represent mean + SEM of n = 5 brains (P0 migrating), 5 brains (P0 layer II), 5 brains (P4), 5 brains (P10), 4 brains (P21), and 3 brains (P45) from at least two independent experiments (one-way ANOVA followed by Bonferroni post-test).

(C) Timeline of the experiment and plasmids used. Coronal slices of P21 brains electroporated at E18 with control plasmid (GFP) (top panel) and dnTCF4 (expressed from E21) (bottom panel) showing cells iontophoretically injected with Lucifer yellow (LY) and their Neurolucida reconstructions.

(D) Quantification of total length and number of branchpoints in apical and basal dendrites of dnTCF4-expressing neurons as a percentage of control cells at P21.

Histograms represent mean±SEM of n = 4 and 5 brains for control and dnTCF4, respectively, from at least two independent experiments (Student’s t test).

Absolute values (mean±SEM): AD length, 1704±150.5mm for control and 896.3±92.64mm for dnTCF4; AD branch points, 32.31±4.637 for control and 11.31± 1.842 for dnTCF4; BD length, 568.7±45.29mm for control and 286.5±28.43mm for dnTCF4; BD branch points, 7.645±1.088 for control and 3.162±0.3503 for dnTCF4. ADs, apical dendrites; BDs, basal dendrites. (E) Quantification of the total branch number for each branch order of control and dnTCF4-expressing neurons at P21. Data represent mean±SEM of n = 7 and 3 brains for control and dnTCF4, respectively, from at least two independent experiments (two-way ANOVA followed by Bonferroni post-test).

**p < 0.01, ***p < 0.001, and ****p < 0.0001. Scale bars, 200mm (A, top panel), 50mm (A, bottom panel, and C), and 20mm (A, right panel).

See alsoFigure S1.

A B

C D

E F

H G

(legend on next page)

Wnt LOF Irreversibly Disrupts Dendritic Development, and Its Role Is Restricted to a Specific Time Window Next, we examined if a transient decrease of canonical Wnt signaling during the postnatal period could cause a long-term deficit in dendritic arbors in the adult. We dox-activated the expression of dnTCF4 from E21 to P15 and analyzed dendritic morphology at P90. Although canonical Wnt activity was restored to physiological levels 4 days after the end of dnTCF4 induction (Figure S2A), we observed significant dendritic defects at P90, indicating that the phenotype is permanent and irrevers- ible (Figures 2A and 2B).

To better define the period during which Wnt signaling is required for a correct dendritic development, we induced dnTCF4 expression during different time windows. dnTCF4 in- duction from E21 to P7 resulted in dendritic defects at P21 (Fig- ures 2C and 2D), while the same manipulation between P7 and P15 and between P15 and P21 had no effect (Figures 2E–2H).

Wnt LOF between E21 and P7 did not affect neuronal identity, as shown by strong immunoreactivity for the pyramidal cell-spe- cific marker SatB2 (Figure S2B). We excluded that the pheno- type was a consequence of perturbed migration, as dnTCF4 induction from P4 to P7 also resulted in reduced dendritic complexity at P21 (Figures S2C and S2D).

Activity-related mechanisms play a critical role in controlling dendritic branching and the formation of dendritic spines (Wong and Ghosh 2002; Sahores and Salinas 2011; Ewald et al., 2008; Frangeul et al., 2017; Cline 2001). To address how canonical Wnt signaling activity relates to neuronal activity- induced mechanisms, we first reduced neuronal excitability by overexpressing the inward-rectifying potassium channel Kir2.1 from E21 to P7 and found no defects in dendritic morphology (Figure S3A). Next, we enhanced neuronal activity using a designer receptors exclusively activated by designer drugs (DREADD)-based chemogenetic approach. We overexpressed hM3Dq and activated it through clozapine-N-oxide (CNO) injec- tions from P0 to P7. Morphometric analysis of P7 hM3Dq-over- expressing cells did not show any difference compared with control cells (Figure S3B). Nonetheless, overexpression of hM3Dq in dnTCF4 cells was able to rescue dendritic length defect (Figure S3C).

Taken together, these results indicate that Wnt dysregulation during early postnatal development leads to irreversible alter-

ations in dendritic arborization. In particular, canonical Wnt activ- ity is necessary for proper dendritic branching during a specific time window (E21–P7), which corresponds to the early phase of dendritogenesis.

Canonical Wnt LOF Impairs Spine Development

We next analyzed spine density in apical dendrites of cells that expressed dnTCF4 from E21 to P7 and found that the density of spines was significantly reduced by more than 30% compared with controls at P30 (Figure 3A). In addition, spine head width was decreased in dnTCF4 neurons compared with controls, while spine head length was not affected (Figure 3B).

Given that we found Wnt signaling to be active until P45 (Fig- ure 1B), but Wnt LOF after P7 did not exert any effect on dendritic arborization (Figures 2E–2H), we hypothesized that canonical Wnt signaling could have a different role in the late phase of den- dritogenesis. We analyzed spine development of cells that ex- press dnTCF4 from P21 to P30 and found a substantial reduction in spine density in both apical and basal dendrites compared with control cells at P30 (Figures 3C and 3D). Moreover, statisti- cal analysis of spine morphology indicates that dnTCF4 cells have an increased proportion of thin spines at the expenses of mushroom spines in the apical dendrites (Figure 3E). Basal den- drites of dnTCF4 neurons show a lower proportion of both stubby and mushroom spines, while filopodia and thin spines are more numerous (Figure 3E). These data indicate that Wnt LOF during the late phase of dendritic development specifically affects spine formation and maturation, without perturbing den- dritic arbor architecture. In addition, neurons that overexpress dnTCF4 from P21 to P30 display significant reduction of spine density at P60, suggesting that spine deficit is persistent (Figure 3F).

In order to examine the impact of Wnt LOF on synapses, we used recombinant antibody-like proteins called FingRs (PSD95.FingR-GFP and GPHN.FingR-GFP) to visualize endoge- nous PSD95 and gephyrin, two postsynaptic markers for excit- atory and inhibitory synapses, respectively (Gross et al., 2013).

We observed and measured a significant decrease in number of PSD95 and gephyrin puncta in dnTCF4 neurons at P30 (Figure 3G).

Finally, we tested whether neuronal activity is involved in spine formation. We overexpressed hM3Dq and activated it with

Figure 2. Wnt LOF Has an Irreversible Effect on Dendritic Development and Acts Only during a Specific Time Window (A) Timeline of the experiment. Neurolucida reconstructions of control cells and neurons expressing dnTCF4 from E21 to P15 analyzed at P90.

(B) Quantification of total length and number of branchpoints in apical and basal dendrites of control and dnTCF4-expressing neurons at P90. Histograms represent mean±SEM of n = 5 and 4 brains for control and dnTCF4, respectively, from at least two independent experiments (Student’s t test).

(C) Timeline of the experiment. Neurolucida reconstructions of control cells and neurons expressing dnTCF4 from E21 to P7 analyzed at P21.

(D) Quantification of total length and number of branchpoints in apical and basal dendrites of control and dnTCF4-expressing neurons at P21, with dnTCF4 expression restricted from E21 to P7. Histograms represent mean±SEM of n = 11 and 5 brains for control and dnTCF4, respectively, from at least two inde- pendent experiments (Student’s t test).

(E) Timeline of the experiment. Neurolucida reconstructions of control cells and neurons expressing dnTCF4 from P7 to P15 analyzed at P21.

(F) Same as (D), with dnTCF4 expression restricted from P7 to P15. Histograms represent mean±SEM of n = 11 and 5 brains for control and dnTCF4, respectively, from at least two independent experiments (Student’s t test).

(G) Timeline of the experiment. Neurolucida reconstructions of control cells and neurons expressing dnTCF4 from P15 to P21 analyzed at P21.

(H) Same as (D), with dnTCF4 expression restricted from P15 to P21. Histograms represent mean±SEM of n = 11 and 10 brains for control and dnTCF4, respectively, from at least two independent experiments (Student’s t test).

Controls in (C)–(H) are the same. *p < 0.05, ***p < 0.001, and ****p < 0.0001. Scale bars, 20mm (A) and 50mm (C, E, and G).

See alsoFigures S2andS3.

A B C

D E

F G

Figure 3. During Late Dendritogenesis, Wnt LOF Reduces Spine and Synapse Densities

(A) Timeline of the experiment. Confocal images of representative apical dendritic segments of P30 control cells and neurons expressing dnTCF4 from E21 to P7.

Quantification of number of spines per micrometer. Histograms represent mean±SEM of n = 6 and 4 brains for control and dnTCF4, respectively (control, 1,810 spines; dnTCF4, 721 spines), from two independent experiments (Student’s t test).

(B) Quantification of spine head width and length. Histograms represent mean±SEM of n = 18 and 12 cells for control and dnTCF4, respectively (control, 299 spines; dnTCF4, 145 spines), from two independent experiments (Student’s t test).

(C) Timeline of the experiment. Confocal images of representative dendritic segments of P30 control cells and neurons expressing dnTCF4 from P21 to P30.

(D) Quantification of number of spines per micrometer. Histograms represent mean±SEM of n = 6 brains/condition (control, 1,810 spines for apical dendrite and 1,110 spines for basal dendrites; dnTCF4, 1,356 spines for apical dendrite and 1,061 spines for basal dendrites) from two independent experiments (Student’s t test).

(E) Percentage of total spines on apical and basal dendrite classified as filopodia, thin, stubby, or mushroom. Histograms represent mean + SEM of n = 18 cells/

condition (control, 371 spines for apical dendrite and 281 spines for basal dendrite; dnTCF4, 387 spines for apical dendrite and 393 spines for basal dendrite) from two independent experiments (two-way ANOVA followed by Bonferroni post-test).

(F) Timeline of the experiment. Confocal images of representative dendritic segments of P60 control cells and neurons expressing dnTCF4 from P21 to P30.

Quantification of number of spines per micrometer. Histograms represent mean±SEM of n = 5 brains/condition (control, 2,351 spines; dnTCF4, 970 spines) from two independent experiments (Student’s t test).

(legend continued on next page)

CNO from P21 to P30. hM3Dq-overexpressing cells showed increased spine density in apical and basal dendrites compared with controls at P30 (Figure S4A). Moreover, overexpression of hM3Dq in dnTCF4 neurons was able to rescue Wnt LOF-induced spine deficit (Figure S4B). We conclude that spine formation in the late phase is affected by neuronal activity.

Overall, these results suggest that canonical Wnt transcrip- tional activity is involved in spine formation and maturation and might play a role in the development of excitatory and inhibitory synapses.

Canonical Wnt Signaling Regulates Dendritic Arborization through NT3 Transcription

Because in the RSC, NT3 was shown to be highly expressed by upper-layer neurons during the early postnatal development (Miyashita et al., 2010), we hypothesized that canonical Wnt signaling might act through NT3 expression to regulate dendri- togenesis. First, we confirmed the presence of NT3 mRNA in the RSC through in situ hybridization (ISH) and found strong NT3 mRNA expression from P0 to P9, which was still present, although weak, at P13 (Figure 4A). To test if NT3 plays a role in dendritic development, we created a short hairpin RNA (shRNA)-specific for NT3 (shNT3) and validated its efficiency in vitro(Figure S5A). We then investigated the role of NT3in vivo and found that shNT3 expression from E21 to P7 resulted in neurons with shorter and less branched apical dendrites compared with control cells at P7 (Figures 4B and 4C). We then tested the hypothesis that NT3 is downstream to Wnt tran- scriptional activity. We electroporated layer II RSC neurons with either a control plasmid (GFP) or dnTCF4 and performed RT- PCR on dissected, fluorescence-activated cell sorting (FACS)- sorted P7 cells. dnTCF4 induction from E21 to P7 produced a 63.5% + 13.7% SEM reduction in NT3 mRNA expression relative to control cells (Figure 4D). Consistent with this, our bioinformatic analysis revealed the presence of several TCF and lymphoid enhancer-binding factor (LEF) binding sites in the NT3 promoter region (Figure 4E). To further confirm the link between NT3 and canonical Wnt signaling, we tested whether NT3 overexpression could rescue Wnt LOF-induced dendritic defects. Indeed, NT3 overexpression during Wnt LOF completely restored dendritic arborization at P7 (Figures 4F and 4G). In addition, when shNT3 expression is induced from P7 to P15, shNT3 neurons display no differences in den- dritic complexity compared with control cells at P15 (Figures S5B and S5C), suggesting that the role of NT3 in dendritogen- esis is also time dependent.

Together, these data strongly support the hypothesis that ca- nonical Wnt signaling acts on early dendritic development of layer II RSC neurons through, at least partly, a transcriptional mechanism regulating NT3 expression.

NT3 Overexpression Rescues the Spine Deficit Induced by Wnt LOF in the Late Phase

Because NT3 has been implicated in synapse formation (Am- mendrup-Johnsen et al., 2015; Han et al., 2016), we assessed its expression using ISH during the late phase of dendritogene- sis. We found that NT3 mRNA was detectable at P21 and P25, while at P31 it was almost absent (Figure 5A). Next, we overex- pressed NT3 and dnTCF4 from P21 to P30 and found that both spine density and maturation were completely rescued in apical and basal dendrites (Figures 5B–5D).

These data suggest that during the late developmental phase, Wnt signaling acts on spine formation by regulating the expres- sion of NT3.

Wnt LOF during the Early Phase Results in Long-Lasting Functional Deficits in the Adult

Because dnTCF4 overexpression in the early phase (E21–P7) irreversibly affected the dendritic morphology, we asked whether this could produce functional deficits in the adult. First, we assessed neuronal activity using the synaptic activity re- porter SAREdGFP (Kawashima et al., 2009) and found a signifi- cant reduction in synaptic activity-responsive element (SARE) intensity in dnTCF4 cells both at P21 and at P45 compared with control (Figures 6A–6C).

Whole-cell patch-clamp recordings in acute slices were also performed, and no changes in intrinsic membrane properties were observed between control and dnTCF4-electroporated neurons at P21 and P45 (Figures 6D–6F; Figures S6A and S6B). No differences were observed in spontaneous excitatory postsynaptic currents (sEPSCs) and spontaneous inhibitory postsynaptic currents (sIPSCs) at P21 (Figures S6C and S6D), as well as in miniature EPSCs and IPSCs (Figures S6E and S6F). Similar results were obtained at P45 (Figures S6G–S6J).

RSC plays an important role in spatial navigation and memory (Czajkowski et al., 2014; Alexander and Nitz 2015; Vedder et al., 2017; Burles et al., 2017); therefore, we tested these behaviors using the open field test and the Barnes maze test (Figures 7A, 7B, and 7F). In the open field test, P30 animals were allowed to freely explore a circular arena for 10 min. dnTCF4 animals traveled a longer distance compared with control littermates, especially during the first 150 s (Figure 7C), and they spent less time immobile compared with controls (Figure 7D). This enhanced locomotor activity was not due to increased anxiety, as the proportion of time spent in the peripheral portion of the maze (external zone) did not differ from controls (Figure 7E).

Thus, Wnt dysregulation during the early phase of dendritogene- sis leads to perturbations in the exploratory behavior of adult animals. To exclude a pure locomotor defect, we performed the cylinder test and the footprint test (Figures S7C and S7D). The cylinder test showed that rearing behavior is the same for dnTCF4

(G) Timeline of the experiment and plasmids used. Left panel: confocal images of representative dendritic segments of control cells and dnTCF4 neurons ex- pressing PSD95.FingR-GFP at P30. Quantification of number of PSD95 puncta per micrometer. Histograms represent mean±SEM of n = 6 brains/condition (control, 1,817 puncta; dnTCF4, 1,018 puncta) from two independent experiments (Student’s t test). Right panel: confocal images of representative dendritic segments of control cells and dnTCF4 neurons expressing GPHN.FingR-GFP at P30. Quantification of number of gephyrin puncta per micrometer. Histograms represent mean±SEM of n = 6 brains/condition (control, 747 puncta; dnTCF4, 366 puncta) from two independent experiments (Student’s t test).

Controls in (A) and (D) are the same. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Scale bars, 5mm (A, C, F, and G).

See alsoFigure S4.

0 600

200 400

Apicaldendriteslength (μm) **

0 15

Apicaldendritesbranch points10 5

** ns

0 400

Basaldendriteslength (μm)

300 200 100

ns

0 15

Basaldendritesbranch points10 5

A _{P3 neg P0 NT3 P3 P9 P13}

Control shNT3 GFP/shNT3

E21

LY

analysisP7 E18

B C

shNT3 Control

D

GFP/dnTCF4 E21

E18 P7

qPCR

F

dnTCF4 C ontrol dnTCF4+NT3

G

Control dnTCF4

*

0 0.5 1.0

Relative NT3 mRNA expression 36%

Control dnTCF4 dnTCF4+NT3

ns

****

0 600

200 400

Apicaldendriteslength (μm) ns

0 15

Apicaldendritesbranch points10 5

*

ns

0 400

Basaldendriteslength (μm)

300 200 100

**

ns ns

0 15

Basaldendritesbranch points10 5 shNT3

pTF hPGK GFP E2A rtTA

NT3

pTF hPGK GFP E2A rtTA

GFP/dnTCF4/dnTCF4+NT3 E21

E18

LY

analysisP7

+271 +1

AUG

CTTATACAAAGGCAAGTAAA

AGTGCAGCCTTTGCT GTCTGGCAAAGGGAGGC

CAAGCACCTCTTTGGTT ACCTCCAAAGTGCTGT

AGTCCTTCAAAGGGATC

CCCAAAGGGACT

ATCTTTCTTTGACTTC -562

-354 -147 +58 +148 -1482 -1064 -773

E

Figure 4. Wnt Acts on Early Dendritic Development through Regulation of NT3 Transcription (A)In situhybridization for NT3 on coronal slices of P0, P3, P9, and P13 brains. neg, negative control.

(B) Timeline of the experiment. Neurolucida reconstructions of control cells and neurons expressing shNT3 from E21 to P7 analyzed at P7.

(legend continued on next page)

and control animals (Figure S7C). As well, the footprint test indi- cated that gait is not perturbed in dnTCF4 animals (Figure S7D).

In order to test spatial learning and memory, electroporated animals performed the Barnes maze test on 3 consecutive days (trials 1, 2, and 3) and 48 h after the third trial (trial 4) (Figures 7F–7H). In the first trial, animals were habituated to the maze.

Consistent with the open field data, we observed an increased latency to find the escape cage in the first trial (Figure 7I), due to increased distance traveled (Figure 7J). During trials 2 and 3, dnTCF4 and control animals learned to navigate the maze with the same efficiency, as indicated by path efficiency (Fig- ure 7K), number of errors/latency, and percentage of time spent in the target quadrant (Figure 7L). Nevertheless, dnTCF4 animals performed worse in trial 4 compared with control littermates. In particular, although control animals improved their path effi- ciency from trial 3 to trial 4, dnTCF4 animals showed decreased path efficiency (Figure 7K). In addition, in trial 4, the number of errors/latency was significantly larger for Wnt LOF animals, and they spent less time in the target quadrant compared with controls (Figure 7M).

Together, these results suggest that impaired dendritic archi- tecture of a subset of neurons in the RSC is sufficient to produce abnormal behavior in spatial exploration and/or navigation and spatial memory, without perturbing spatial learning.

DISCUSSION

Our results reveal a role for canonical Wnt signaling in regulating dendritic development of upper-layer pyramidal neuronsin vivo, in a normal physiological context during cortical development.

Temporary downregulation of canonical Wnt transcriptional ac- tivity during a specific, early postnatal time window results in se- vere defective dendritic arborization that persists until adult age.

Canonical Wnt LOF has also a strong impact on spine formation.

Finally, we demonstrate that defective dendritic architecture due to transient disruption of canonical Wnt signaling of only a subset of layer II pyramidal neurons leads to long-term behavioral ab- normalities in spatial navigation and memory.

In previous studies, we described a dynamic regulation of ca- nonical Wnt activity during radial migration of layer II and III cal- losal projection neurons (Boitard et al., 2015; Bocchi et al., 2017).

Here we demonstrate that canonical Wnt signaling activity is high in cells when they are positioned in layer II and start dendritic development. This activity pattern of canonical Wnt signaling is in agreement with the known expression pattern of Wnt ligands

and other elements, such as TCF4, of the canonical Wnt pathway (Shimogori et al., 2004; Coyle-Rink et al., 2002). In addition, ca- nonical Wnt signaling has been shown to be highly active in neu- rons from other layers at the end of migration (Woodhead et al., 2006). Several Wnt ligands have been implicated in dendritogen- esisin vitro(Wayman et al., 2006; Hiester et al., 2013). Most of them act through non-canonical,b-catenin-independent path- ways, regulating cytoskeleton organization and dynamics, both in vitro(Rosso et al., 2005; Terabayashi et al., 2007; Hagiwara et al., 2014; Okerlund et al., 2016; Kwan et al., 2016) andin vivo (Gonc¸alves et al., 2016; Chen et al., 2017; Lanoue et al., 2017).

Here, we demonstrate that canonical Wnt transcriptional activity has a dual role in dendritic development, depending on the developmental stage of neurons, during two specific time win- dows: first, between E21 and P7 it promotes dendritic growth and branching, as well as spine formation; later, between P21 and P30 it only regulates spine formation. The role of canonical Wnt transcriptional activity in dendritic development we report here appears to be a general phenomenon in pyramidal neurons, as Wnt LOF in both layer II RSC neurons and layer II and III neu- rons of S1 results in reduced dendritic arborization.

After manipulating neuronal activity during the initial phase of dendritic development (E21–P7), we could not detect any signif- icant changes in dendritic morphology. On the other hand, we show that neuronal activity had a clear impact on spine formation during the late phase (P21–P30). It should be emphasized that if canonical Wnt signaling is downregulated during the early phase, increasing neuronal activity by hM3Dq activation is able to partially rescue dnTCF4-induced dendritic phenotype. The lack of effect of neuronal activity during the initial phase of dendritic development is somewhat surprising in view of the well-established role of input-dependent neuronal activity in dendritogenesis (Wong and Ghosh 2002; Sahores and Salinas 2011; Ewald et al., 2008; Frangeul et al., 2017; Cline 2001; Miz- uno et al., 2014; Li et al., 2013; Datwani et al., 2002). For example, several articles report a role of thalamic input-depen- dent (N-methyl-D-aspartic acid [NMDA] receptor-driven) neuronal activity in the formation of dendritic arbor of layer IV neurons in the S1 (Mizuno et al., 2014; Li et al., 2013; Frangeul et al., 2017; Datwani et al., 2002). However, when thalamocorti- cal axons reach layer IV, the dendritic development of spiny stel- late neurons had already started (Callaway and Borrell 2011), so it is likely that activity-dependent changes reported in earlier studies involve later phases of dendritic maturation and not the initial stages of dendritic growth. Given that the expression of

(C) Plasmid used. Quantification of total length and number of branchpoints in apical and basal dendrites of control and shNT3-expressing neurons at P7.

Histograms represent mean±SEM of n = 10 and 6 brains for control and shNT3, respectively, from at least two independent experiments (Student’s t test).

(D) Timeline of the experiment. Quantification of NT3 mRNA expression of dnTCF4-expressing neurons relative to control cells at P7. Histograms represent mean + SEM of n = 2 litters/condition (12 brains/condition in total) (Student’s t test).

(E) NT3 promoter and beginning of exon 1 sequences (3,710 nucleotides, National Center for Biotechnology Information [NCBI] GenBank: S75812.1) contain eight potential TCF-LEF binding sites (red). +1 is the mRNA transcription start site. +271 AUG is NT3 protein start codon.

(F) Timeline of the experiment and plasmid used. Neurolucida reconstructions of control, dnTCF4-expressing neurons, and cells that co-express dnTCF4 and NT3 (dnTCF4+NT3) at P7.

(G) Quantification of total length and number of branchpoints in apical and basal dendrites of control, dnTCF4-expressing neurons, and cells that co-express dnTCF4 and NT3 (dnTCF4+NT3) at P7. Histograms represent mean±SEM of n = 10, 4, and 10 brains for control, dnTCF4, and dnTCF4+NT3, respectively, from at least two independent experiments (one-way ANOVA followed by Bonferroni post-test).

*p < 0.05, **p < 0.01, and ****p < 0.0001. Scale bar, 200mm (A) and 20mm (B and E).

See alsoFigure S5.

synaptic Zinc (marker of experience-dependent synaptic plas- ticity) in RSC bundles starts at P11 (Miro´-Bernie´ et al., 2006) (i.e., after the early phase), we hypothesize that during the activ- ity-independent dendritic growth period (E21–P7), the thalamo- cortical inputs coming from the anterior thalamic nuclei (a major input of layer II RSC neurons) have not yet reached their target in layer II. Additional experiments are required to determine if input- dependent regulation plays a role in dendritic maturation of layer II dendritic bundle cells after P11.

We found that canonical Wnt transcriptional activity regulates spine density and maturation, as well as the density of excitatory (PSD95) and inhibitory (gephyrin) postsynaptic proteins. This is in agreement with previously published results indicating that several components of the canonical Wnt-b-catenin pathway are localized in postsynaptic densities of excitatory synapses in cultured hippocampal neurons (Schmeisser et al., 2009). Inter- estingly, upon NMDA activation, b-catenin migrates from the synapse to the nucleus, where it activates the transcription of

dnTCF4 dnTCF4 NT3

Basal Dendrite Apical Dendrite

dnTCF4 dnTCF4 NT3

A P21 NT3 P25 P31

dnTCF4/dnTCF4+NT3 P21

LY

analysisP30 E18

B C

Control dnTCF4 dnTCF4+NT3 ns

Apical dendrites

0 1.0

0.6 0.8

Nb of spines/μm

0.4 0.2

* ^ns

Basal dendrites

0 1.0

0.6 0.8

Nb of spines/μm

0.4 0.2

*

D

ns ns ns ns

nsns

Apical dendrites

0 20 40 80

% of total spines

60 ****

****

filopodia thin stubby mushroom

nsns

ns

nsns

ns

Basal dendrites

0 20 40 80

% of total spines

60 ****

****

filopodia thin stubby mushroom

Figure 5. During Late Dendritogenesis, Spine Density Is Rescued by NT3 Overexpression (A)In situhybridization for NT3 on coronal slices of P21, P25, and P31 brains.

(B) Timeline of the experiment. Confocal images of representative dendritic segments of dnTCF4-expressing neurons and cells that co-express dnTCF4 and NT3 (dnTCF4+NT3) at P30.

(C) Quantification of number of spines per micrometer. Histograms represent mean±SEM of n = 6 brains/condition (control, 1,810 spines for apical dendrite and 1,110 spines for basal dendrites; dnTCF4, 1,356 spines for apical dendrite and 1,061 spines for basal dendrites; dnTCF4+NT3, 1,839 spines for apical dendrite and 1,660 spines for basal dendrites) from two independent experiments (one-way ANOVA followed by Bonferroni post-test).

(D) Percentage of total spines on apical and basal dendrite classified as filopodia, thin, stubby, or mushroom. Histograms represent mean + SEM of n = 18 cells/

condition (control, 371 spines for apical dendrite and 281 spines for basal dendrite; dnTCF4, 387 spines for apical dendrite and 393 spines for basal dendrite;

dnTCF4+NT3, 404 spines for apical dendrite and 428 spines for basal dendrite), from two independent experiments (two-way ANOVA followed by Bonferroni post-test).

*p < 0.05 and ****p < 0.0001. Scale bar, 200mm (A) and 5mm (B).

canonical Wnt target genes (Schmeisser et al., 2009). A more recent study found that mice knock out (KO) forDixdc1, a cyto- plasmic transducer of canonical Wnt signaling, show reduced spine density in apical dendrites of layer V neurons of the pre- frontal cortex (Martin et al., 2018). In addition, those neurons also present a higher percentage of filopodia and a lower density of PSD95 puncta. There is also evidence thatb-catenin localizes at postsynaptic densities of GABAergic synapses as well as in

the nucleus of cultured hippocampal neurons during synapto- genesis (Benson and Tanaka 1998). In agreement with these data, we found a significant decrease not only in spine density but also in PSD95 puncta density in dnTCF4-expressing neu- rons. The expression of dnTCF4 during the late phase also led to a reduction of gephyrin puncta density, suggesting a possible deficiency in GABAergic synapses. Our data on the expression of postsynaptic markers, together with previous published A

B C

D

E F

Figure 6. Wnt LOF during Early Development Reduces Activity-Dependent Transcription of Early Immediate Genes (A) Timeline of the experiment and plasmid used.

(B) Coronal slices of P21 brains electroporated at E18 with either TOM/SAREdGFP or dnTCF4/SAREdGFP, with dnTCF4 expression from E21 to P7, showing decreased SARE expression in dnTCF4 cells. Quantification of SARE intensity/TOM intensity. Histograms represent mean±SEM of n = 4 brains/condition (control, 943 cells; dnTCF4, 584 cells) from at least two independent experiments (Student’s t test).

(C) Coronal slices of P45 brains electroporated as in (B), showing decreased SARE expression in dnTCF4 cells. Quantification of SARE intensity/TOM intensity.

Histograms represent mean±SEM of n = 6 and 5 brains for control (715 cells) and dnTCF4 (443 cells), respectively, from at least two independent experiments (Student’s t test).

(D) Timeline of the experiment.

(E) Example traces of firing properties of control and dnTCF4 electroporated cells in response to depolarizing current injection at P21. Graph represents fre- quencies of action potentials in response to different depolarizing current injections. Data represent mean±SEM of n = 12 and 9 cells for control and dnTCF4, respectively. No significant difference was measured between the two conditions (two-way ANOVA).

(F) Same as (E) at P45. Data represent mean±SEM of n = 7 cells/condition. No significant difference was measured between control and dnTCF4 cells (two-way ANOVA).

*p < 0.05 and **p < 0.01. Scale bar, 50mm (B and C).

See alsoFigure S6.

A

B C D E

F

H

G

J K

I

L M

Figure 7. Wnt LOF during Early Development Leads to Functional Deficits at Adult Age (A) Timeline of behavioral experiments.

(B) Open field test showing higher distance traveled by dnTCF4 animals compared with control.

(C) Quantification of distance traveled every 150 s. n = 25 and 17 animals for control and dnTCF4, respectively (repeated-measures two-way ANOVA followed by Bonferroni post-test).

(D) Proportion of time spent immobile and mobile. n = 25 and 17 animals for control and dnTCF4, respectively (Student’s t test).

(E) Proportion of time spent in the internal and external zones. n = 25 and 17 animals for control and dnTCF4, respectively (Student’s t test).

(F) Barnes maze test showing spatial memory deficit in dnTCF4 animals.

(G) Timeline of Barnes maze test experiments.

(H) Schematic of Barnes maze and representative track plots of control and dnTCF4 animals in trial 4.

(I) Quantification of latency to find the escape cage. n = 24 and 18 animals for control and dnTCF4, respectively.

(J) Quantification of distance traveled in trial 1. n = 24 and 18 animals for control and dnTCF4, respectively (Student’s t test).

(K) Quantification of path efficiency. n = 24 and 18 animals for control and dnTCF4, respectively.

(L) Quantification of number of errors normalized on latency and percentage of time spent in the target quadrant as average of trial 2 and 3. n = 24 and 18 animals for control and dnTCF4, respectively (Student’s t test).

(legend continued on next page)

results suggest that canonical Wnt signaling plays a role in the development of both excitatory and inhibitory synapses.

To identify the downstream effector of canonical Wnt tran- scription, we focused on the neurotrophic factor NT3, which has been shown to be important for dendritic development bothin vitro(McAllister et al., 1995, 1997; Baker et al., 1998;

Gascon et al., 2005) andin vivo(Miyashita et al., 2010; Yang et al., 2012) and in spine development (Ammendrup-Johnsen et al., 2015; Han et al., 2016). In addition, RSC neurons express high levels of NT3 transcript during the first postnatal week (Miyashita et al., 2010). We found that NT3 knockdown during the early phase affects the length and complexity of apical den- drites, whereas basal dendrites remain normal. It is possible that the growth of basal dendrites is not regulated by NT3 but by other neurotrophins, such as BDNF (Horch and Katz 2002;

Gascon et al., 2005; Niblock et al., 2000). Indeed, previous studies have shown that the growth of apical and basal dendrites of the same cell is differentially regulated by different neurotro- phins (McAllister et al., 1995; Niblock et al., 2000). An alternative explanation might be a compensatory mechanism in which the lack of NT3 in basal dendrites is compensated by the presence of other neurotrophins (e.g., BDNF).

Previous studies suggested that NT3 expression might be regulated by Wnt signaling, at least in certain cell types (Pata- poutian et al., 1999; Fragoso et al., 2011). In the present study, we found that dnTCF4 overexpression during the first postnatal week resulted in a two-thirds decrease in NT3 mRNA (Figure 4D), and NT3 overexpression was able to rescue dnTCF4-induced defective arborization. In addition, using a transcription factor binding sites web tool (http://alggen.lsi.upc.es), we found eight TCF and LEF binding sites in the NT3 promoter and exon 1 sequence. It should be noted that we cannot exclude the possi- bility that Wnt-TCF4-dependent transcription could also indi- rectly regulate NT3 transcription through other transcription factors. However, our results strongly support the hypothesis that NT3 is a downstream effector of canonical Wnt signaling.

Moreover, the presence of NT3 transcript at P21 and P25 and the ability of NT3 overexpression to rescue both spine density and maturation suggest that NT3 is downstream to canonical Wnt transcriptional activity also during the late phase of dendritic development.

We found that neurons with deficient dendritic development display significantly reduced neuronal activity at P21 and P45.

This reduction in SARE intensity might be due to perturbations in the activity-dependent pathways that induce transcriptional regulation of early immediate genes (Kawashima et al., 2009; In- oue et al., 2010). Our electrophysiological experiments revealed that dnTCF4 cells are functional because intrinsic membrane properties are not affected compared with controls. They dis- played late-spiking firing property as described by Kurotani et al. (2013). Consistent with our results,Peng et al. (2009)found no difference in miniature EPSCs (mEPSCs) in neurons with reduced dendritic arborization. In addition, it must be noted

that important RSC connections include distant regions of the brain, such as the anterior thalamic nuclei (Odagiri et al., 2011).

These long-range afferents are dissected in acute slice prepara- tions, which may account for the lack of phenotype in sponta- neous activity.

Given the significant decrease in spine density found in apical dendrites following dnTCF4 expression from E21 to P7 (seeFig- ure 3A), we expected to find electrophysiological differences about synaptic event frequency between control and dnTCF4 neurons. However, our experiments showed no perturbation in spontaneous as well as miniature postsynaptic currents both at P21 and P45 (seeFigure S6). Although one would expect a direct correlation between spine density and mEPSC frequency, it is in fact not necessarily the case. Several studies showed that mEPSC frequency can be unchanged in case of an altered num- ber of spines or conversely a change in miniature frequency might be observed in case of no change in spine density (Booker et al., 2018; Keck et al., 2013; Liao et al., 2001; Smith et al., 2014).

The discrepancy between the two parameters (spine density and mini frequency) can be explained for example by a change in the number of silent synapses, the stage of maturation of spines or the level of multi-innervation done by several axonal boutons on the same spine. Future work will be necessary to disentangle the origin of the difference we observed.

Finally, we found that affecting the dendritic development of only a fraction of layer II pyramidal neurons in RSC is sufficient to result in long-term alterations in spatial navigation and mem- ory in the adult. Our findings lend support to the notion estab- lished by previous published lesion studies that RSC plays a crucial role in spatial navigation and memory (for review see Vann et al., 2009). In addition, they provide the first evidence link- ing altered dendritic development of a specific neuronal subtype in the RSC to spatial navigation and memory defect. The present study may provide a new framework for understanding how deregulation of Wnt signaling could affect cortical development, thereby potentially underlying neuropsychiatric disorders previ- ously linked to Wnt signaling (Brennand et al., 2011; De Ferrari and Moon 2006; Lovestone et al., 2007).

STAR+METHODS

Detailed methods are provided in the online version of this paper and include the following:

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS B Wistar rats

B HEK293T/17 cell line

d METHODS DETAILS B Plasmids

B In Utero Electroporation

B Iontophoretic post hoc single cell injections

(M) Quantification of number of errors normalized on latency and percent of time spent in the target quadrant in trial 4. n = 24 and 18 animals for control and dnTCF4, respectively (Student’s t test).

*p < 0.05 and ***p < 0.001.

See alsoFigure S7.

B Immunofluorescence andin situhybridization B Image acquisition and analysis

B Analysis of Neuronal Cytoarchitecture B Cell transfection for shNT3 validation

B Tissue dissection, FACS-sorting and RNA extraction B Quantitative Real-Time PCR Analysis

B Acute slice preparation and electrophysiologal record- ings

B Behavioral tests

d QUANTIFICATION AND STATISTICAL ANALYSIS

d ADDITIONAL RESOURCES SUPPLEMENTAL INFORMATION

Supplemental Information can be found online athttps://doi.org/10.1016/

j.celrep.2019.04.026.

ACKNOWLEDGMENTS

We thank Elodie Husi and Cynthia Saadi, FACS Core Facility and Bioimaging Core Facility of the University of Geneva, for technical assistance; Prof. D.

Muller for the SAREdGFP plasmid; and Prof. D. Jabaudon for the Kir2.1 plasmid. This work was supported by the Swiss National Foundation (grant 31003A_159795/1) to J.Z.K.

AUTHOR CONTRIBUTIONS

B.V. and J.Z.K. conceived the experiments and wrote the manuscript. L.A. and L.V. contributed to the conception of the experiments. B.V. and L.S. performed the experiments and analyzed data. B.V. and V.P. performedin uteroelectro- poration. A. Contestabile helped with the behavioral experiments. R.B. helped with TOPdGFP analysis. P.S. helped clone constructs. A.-L.W.C. and A. Car- leton performed patch-clamp experiments.

DECLARATION OF INTERESTS

The authors declare no competing interests.

Received: August 7, 2018 Revised: February 28, 2019 Accepted: April 3, 2019 Published: April 30, 2019 REFERENCES

Alexander, A.S., and Nitz, D.A. (2015). Retrosplenial cortex maps the conjunc- tion of internal and external spaces. Nat. Neurosci.18, 1143–1151.

Amit, S., Hatzubai, A., Birman, Y., Andersen, J.S., Ben-Shushan, E., Mann, M., Ben-Neriah, Y., and Alkalay, I. (2002). Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev.

16, 1066–1076.

Ammendrup-Johnsen, I., Naito, Y., Craig, A.M., and Takahashi, H. (2015). Neu- rotrophin-3 enhances the synaptic organizing function of TrkC-protein tyrosine phosphatasesin rat hippocampal neurons. J. Neurosci.35, 12425–12431.

Arikkath, J. (2012). Molecular mechanisms of dendrite morphogenesis. Front.

Cell. Neurosci.6, 61.

Baker, R.E., Dijkhuizen, P.A., Van Pelt, J., and Verhaagen, J. (1998). Growth of pyramidal, but not non-pyramidal, dendrites in long-term organotypic explants of neonatal rat neocortex chronically exposed to neurotrophin-3. Eur. J. Neu- rosci.10, 1037–1044.

Benson, D.L., and Tanaka, H. (1998). N-cadherin redistribution during synap- togenesis in hippocampal neurons. J. Neurosci.18, 6892–6904.

Bocchi, R., Egervari, K., Carol-Perdiguer, L., Viale, B., Quairiaux, C., De Roo, M., Boitard, M., Oskouie, S., Salmon, P., and Kiss, J.Z. (2017). Perturbed

Wnt signaling leads to neuronal migration delay, altered interhemispheric con- nections and impaired social behavior. Nat. Commun.8, 1158.

Boitard, M., Bocchi, R., Egervari, K., Petrenko, V., Viale, B., Gremaud, S., Zgraggen, E., Salmon, P., and Kiss, J.Z. (2015). Wnt signaling regulates multi- polar-to-bipolar transition of migrating neurons in the cerebral cortex. Cell Rep.10, 1349–1361.

Booker, S.A., Domanski, A.P.F., Dando, O.R., Jackson, A.D., Isaac, J.T.R., Hardingham, G.E.H., Wyllie, D.J.A., and Kind, P.C. (2018). Altered dendritic spine function and integration in a mouse model of fragile X syndrome. bioRxiv.

https://doi.org/10.1101/396986.

Bourgin, C., Murai, K.K., Richter, M., and Pasquale, E.B. (2007). The EphA4 re- ceptor regulates dendritic spine remodeling by affecting beta1-integrin signaling pathways. J. Cell Biol.178, 1295–1307.

Brennand, K.J., Simone, A., Jou, J., Gelboin-Burkhart, C., Tran, N., Sangar, S., Li, Y., Mu, Y., Chen, G., Yu, D., et al. (2011). Modelling schizophrenia using hu- man induced pluripotent stem cells. Nature473, 221–225.

Briner, A., De Roo, M., Dayer, A., Muller, D., Habre, W., and Vutskits, L. (2010).

Volatile anesthetics rapidly increase dendritic spine density in the rat medial prefrontal cortex during synaptogenesis. Anesthesiology112, 546–556.

Burles, F., Slone, E., and Iaria, G. (2017). Dorso-medial and ventro-lateral func- tional specialization of the human retrosplenial complex in spatial updating and orienting. Brain Struct. Funct.222, 1481–1493.

Callaway, E.M., and Borrell, V. (2011). Developmental sculpting of dendritic morphology of layer 4 neurons in visual cortex: influence of retinal input.

J. Neurosci.31, 7456–7470.

Cane, M., Maco, B., Knott, G., and Holtmaat, A. (2014). The relationship be- tween PSD-95 clustering and spine stability in vivo. J. Neurosci.34, 2075–

2086.

Chen, C.-M., Orefice, L.L., Chiu, S.L., LeGates, T.A., Hattar, S., Huganir, R.L., Zhao, H., Xu, B., and Kuruvilla, R. (2017). Wnt5a is essential for hippocampal dendritic maintenance and spatial learning and memory in adult mice. Proc.

Natl. Acad. Sci. U S A114, E619–E628.

Chenn, A., and Walsh, C.A. (2002). Regulation of cerebral cortical size by con- trol of cell cycle exit in neural precursors. Science297, 365–369.

Ciani, L., Boyle, K.A., Dickins, E., Sahores, M., Anane, D., Lopes, D.M., Gibb, A.J., and Salinas, P.C. (2011). Wnt7a signaling promotes dendritic spine growth and synaptic strength through Ca²⁺/Calmodulin-dependent protein ki- nase II. Proc. Natl. Acad. Sci. USA108, 10732–10737.

Clark, C.E.J., Richards, L.J., Stacker, S.A., and Cooper, H.M. (2014). Wnt5a in- duces Ryk-dependent and -independent effects on callosal axon and dendrite growth. Growth Factors32, 11–17.

Cline, H.T. (2001). Dendritic arbor development and synaptogenesis. Curr.

Opin. Neurobiol.11, 118–126.

Coyle-Rink, J., Del Valle, L., Sweet, T., Khalili, K., and Amini, S. (2002). Devel- opmental expression of Wnt signaling factors in mouse brain. Cancer Biol.

Ther.1, 640–645.

Czajkowski, R., Jayaprakash, B., Wiltgen, B., Rogerson, T., Guzman-Karlsson, M.C., Barth, A.L., Trachtenberg, J.T., and Silva, A.J. (2014). Encoding and stor- age of spatial information in the retrosplenial cortex. Proc. Natl. Acad. Sci. U S A111, 8661–8666.

Datwani, A., Iwasato, T., Itohara, S., and Erzurumlu, R.S. (2002). NMDA recep- tor-dependent pattern transfer from afferents to postsynaptic cells and den- dritic differentiation in the barrel cortex. Mol. Cell. Neurosci.21, 477–492.

David, M.D., Cantı´, C., and Herreros, J. (2010). Wnt-3a and Wnt-3 differently stimulate proliferation and neurogenesis of spinal neural precursors and pro- mote neurite outgrowth by canonical signaling. J. Neurosci. Res.88, 3011–

3023.

De Ferrari, G.V., and Moon, R.T. (2006). The ups and downs of Wnt signaling in prevalent neurological disorders. Oncogene25, 7545–7553.

Ewald, R.C., Van Keuren-Jensen, K.R., Aizenman, C.D., and Cline, H.T. (2008).

Roles of NR2A and NR2B in the development of dendritic arbor morphology in vivo. J. Neurosci.28, 850–861.