Article
Reference
The bacterial phleomycin resistance gene ble as a dominant selectable marker in Chlamydomonas
STEVENS, David R., ROCHAIX, Jean-David, PURTON, Saul
Abstract
A chimeric gene composed of the coding sequence of theble gene from Streptoalloteichus hindustanus fused to the 5′ and 3′ untranslated regions of the Chlamydomonas reinhardtii nuclear gene RBCS2 has been constructed. Introduction of this chimeric gene into the nuclear genome of C. reinhardtii by co-transformation with the ARG7 marker yields Arg⁺ transformants of which approximately 80% possess the ble gene. Of these co-transformants, approximately 3% display a phleomycin-resistant (PmR) phenotype. Western blot analysis using antibodies against the ble gene product confirms the presence of the protein in the PmR transformants and genetic analysis demonstrates the co-segregation of the ble gene with the phenotype in progeny arising from the mating of a PmR transformant to wild-type strains. Direct selection of PmR transformants was achieved by allowing an 18-h period for recovery and growth of transformed cells prior to selection. This work represents the first demonstration of stable expression and inheritance of a foreign gene in the nuclear genome of C. reinhardtii and provides a useful dominant marker for nuclear [...]
STEVENS, David R., ROCHAIX, Jean-David, PURTON, Saul. The bacterial phleomycin resistance gene ble as a dominant selectable marker in Chlamydomonas . Molecular and General Genetics , 1996, vol. 251, no. 1, p. 23-30
DOI : 10.1007/BF02174340
Available at:
http://archive-ouverte.unige.ch/unige:130349
Disclaimer: layout of this document may differ from the published version.
1 / 1
David R. Stevens • Jean-David Roehaix • Saul Purton
The bacterial phleomycin resistance gene ble
as a dominant selectable marker in Chlamydomonas
Received: 31 August 1995/Accepted: 4 December 1995
Abstract A chimeric gene composed of the coding se- quence of the bIe gene from Streptoalloteichus hindu- stanus fused to the 5' and 3' untranslated regions of the Chlamydomonas reinhardtii nuclear gene RBCS2 has been constructed. Introduction of this chimeric gene into the nuclear genome of C. reinhardtii by co-trans- formation with the ARG7 marker yields Arg + trans- formants of which approximately 80% possess the bIe gene. Of these co-transformants, approximately 3%
display a phleomycin-resistant (Pro R) phenotype. West- ern blot analysis using antibodies against the ble gene product confirms the presence of the protein in the Pm R transformants and genetic analysis demonstrates the co-segregation of the ble gene with the phenotype in progeny arising from the mating of a Pm ~ transformant to wild-type strains. Direct selection of Pm l~ transform- ants was achieved by allowing an 18-h period for recov- ery and growth of transformed cells prior to selection.
This work represents the first demonstration of stable expression and inheritance of a foreign gene in the nuclear genome of C. reinhardtii and provides a useful dominant marker for nuclear transformation.
Key words C h l a m y d o m o n a s • Transformation •
Dominant marker • ble
Introduction
Early attempts to develop a nuclear transformation system for the green unicellular alga Chlamydomonas reinhardtii relied on the introduction and expression of Communicated by E. CerdS.-Olmedo
D. R. Stevens. S. Purton (~)
Department of Biology, University College London, Gower Street, London, WC1E 6BT, UK
J.-D. Rochaix
Department of Molecular Biology, University of Geneva, 30 Quai Ernest-Ansermet, 1211 Geneva, Switzerland
foreign genes in this organism. Rochaix and van Dil- lewijn (1982) reported complementation of the argi- nine-requiring mutant arg7 with the yeast gene ARG4 encoding argininosuccinate lyase. Hasnain et al. (1985) and Bingham et al. (1989) have also described foreign gene expression based on the expression of the bacterial neomycin phosphotransferase II gene. However, trans- formation rates in all cases were very low, often comparable with rates of reversion or mutation to spontaneous resistance. Moreover, putative transform- ants were usually unstable. Whilst efficient nuclear transformation has now been achieved based on the use of cloned C. reinhar&ii genes to complement corres- ponding mutations (e.g. Debuchy et al. 1989; Kindle et al. 1989; Mayfield and Kindle 1990), the problem of foreign gene expression has remained (Day et al. 1990;
Blankenship and Kindle 1992; Kindle and Sodeinde 1994). In spite of numerous attempts, a clear demon- stration of stable integration, expression and inherit- ance of a foreign gene in Chlamydomonas has not been forthcoming. Possible explanations for this failure include the silencing of introduced genes by methyla- tion (Blankenship and Kindle 1992), inappropriate codon usage in the foreign gene compared to the highly selective codon usage seen in ChIamydomonas genes (Rochaix 1987), ectopic effects (Kindle and Sodeinde 1994) and lack of introns or other non- coding elements (Stevens and Purton 1994). Recently, Hall et al. (1993) have reported the introduction of the NPTII gene into the nucleus of Chlamydomonas and demonstrated NPTII activity in these transformants.
However, the co-segregation of the gene with NPTII activity in progeny resulting from sexual crosses was not tested.
In this work, we report the introduction and expres- sion of the phleomycin (Pm) resistance gene (ble) from Streptoalloteichus hindustanus in Chlamydomonas. This gene was chosen for its small size and because its codon usage parallels that of C. reinhardtii genes. Analysis of phleomycin-resistant transformants demonstrates that
24
they (i) harbour the ble gene; (ii) show stable resistance to phleomycin; (iii) synthesize the bIe gene product, and (iv) show co-segregation of the introduced gene with the Pm ~ phenotype. We also show that direct selection of Pm R transformants is possible, making the ble gene a useful dominant marker for transformation.
and TTGGTCGaCGTCGGTtAGTCC, respectively [intiation codon is shown in bold, MseI and SaII sites used in cloning are underlined, lower case represents changes introduced to create the SalI site or improve codon usage with respect to C. reinhardtii nuclear genes (Rochaix 1987)]. The 395-bp PCR product was cut with MscI and SaII and cloned into pSP105 to create pSP108 (Fig. 1). The RBCS2- ble junction was confirmed by DNA sequencing.
Materials and methods Nuclear transformation of C. reinhardtii Strains and media
The recA- Escherichia coti strain XL1-Blue (Stratagene) was used in all recombinant DNA work. The C. reinhardtii strains used were the cell-wall deficient, arginine-requiring mutant 363 (a~7-8 cwa. m t - ), the cell-wall deficient strains CC-278 (cwlS.mt - ) and CC-2656 (cwa.mt-) and the wild-type strains CC-1021 (mt +) and CC-125 (nat+). These strains were obtained from the Chlamydomonas Culture Collection at Duke University (Harris 1989), with the exception of 363 which was a gift from R. Loppes (University of Li6ge). C. reinhardtii was grown in TRIS-acetate- phosphate (TAP) medium (Gorman and Levine 1965) supplemented with 50 mg/1 arginine where required. Cultures were incubated in the light (45 gE/m2/s) at 22 ° C. Inheritance of the Pm R phenotype was investigated in crosses between transformant Pm65(mt-) and the wild-type strains as described by Harris (1989). Phleomycin resist- ance was scored by spotting 5 gl of cells grown in TAP to stationary phase onto TAP-agar plates containing 2 gg/ml Pro. Resistance levels in liquid culture were determined by adding 0.2 ml of cell culture to 25 ml of TAP containing a range of Pm concentrations and scoring for cell growth after 5 days.
Construction of pSP]05 and pSPI08
The expression vector pSP105 was made by amplifying a 794-bp element from the 5' untranslated region (UTR) of the C. reinhardtii gene RBCS2 (Goldschmidt-Clermont and Rahire 1986) using the sense and antisense primers TGGACCGAAATTCGGAGTCCCCTGCACG and gggtcgacgcacgtGGCCATTTTAAGATGTT, respectively. (Up- per case represents RBCS2 sequence, A is a single base deletion that creates an EcoRI site, and lower case represents a novel sequence that introduces MscI, PmlI and SalI sites immediately downstream of the underlined initiation codon). The product was cloned into the HincII site of pBluescribe M13 ÷ (Stratagene) to make plasmid pSP104. A 231-bpEco47III fragment from the 3' UTR of RBCS2 that includes the stop codon and the polyadenylation signal was cloned into the Sinai site of pSP104 to create pSP105 (Fig. 1). To make pSP108, the coding sequence of the ble gene was amplified from plasmid pUT430 (Drocourt et al. 1990) using the sense and antisense primers GTATCGATGGCCAAGcTGACCAGcGCCG
Co-transformation of strain 363 with the plasmids pARGZ8 (Debuchy et al. 1989) and pSP108 was carried out as described in Gumpel et al. (1994). For direct selection of phleomycin-resistant transformants, cells were grown to a density of 2 x 106/ml, harvested by centrifugation and resuspended in TAP to a final concentration of 2 x 108/ml. Cells (0.3 ml) were vortexed for 15 s with 0.3 g of 0.5 mm glass beads and 2 gg of pSP108, together with 100 gl of sterile 20% (v/v) polyethylene glycot (PEG) where required. The vortexed cells were diluted in 20 ml TAP liquid medium and left to express the ble gene by incubating at 25°C, 80 gE/m2/s for 18 h with gentle shaking. Cells were then pelleted by centrifugation, resusp- ended in 4 ml of TAP containing 0.6% molten agar and poured onto the surface of a TAP agar plate containing 2 gg/ml phleomycin.
Plates were incubated at 22 ° C in the light (45 gE/m2/s). Transform- ants appeared after 7-8 days.
DNA analysis
Total genomic DNA was prepared from C. reinhar&ii using the 'miniprep' method described by Rochaix et al. (1988). Restriction digestion, gel electrophoresis and transfer to nylon membranes (Hybond-N; Amersham) were according to standard protocols (Sambrook et al. 1989). Radiolabelled DNA probes were prepared using the method of Feinberg and Vogelstein (1984). Probes used were (i) the 395-bp PCR fragment containing the ble coding se- quence; (ii) the 1.4-kb EcoRI fragment of pSP108, and (iii) the 650- bp BamHI-NcoI region of RBCS2 (Goldschmidt-Clermont and Rahire 1986). Hybridisation was at 42 ° C overnight in 50% formam- ide, 5 x SSC, 5 x Denhardt's solution, 0.1% SDS, 0.1 mg/ml salmon sperm DNA. Washing of membranes was at 65 ° C in 0.1 x SSC, 0.t% SDS.
Fig. 1 Schematic diagram of ptasmids pSP105 and pSP108. Se- quences from the 5' and 3' untranslated regions of RBCS2 are shown as open boxes. The transcription start site, putative polyadenylation signal, start codon (ATG) and stop codon (TAA) of RBCS2 are indicated on pSP105. The start and stop codons of the phleomycin resistance gene, bte (stippled box), are indicated on pSP108. Unique restriction sites together with the two EcoRI sites are shown below each plasmid
pSPI05
Hindlll EcoRI pSPI08
5' RBCS2
transcription start poly A signal
~ATG TAA 1
H 3' RBCS2 h'~ pBluescribe Mscl Pmll Sail Xbal BamHt Kpnl EcoRl
] 200 bp, I Hindlll EcoRI
-7t
ATG bte TAA
Mscl Salt Xbal BamHI Kpnl EcoRl
Western analysis
Total soluble protein was isoIated from 25-ml cultures of
Chlamydomonas grown to 5 x 106 cells/ml. Pelleted cells were washed in protein sample buffer (5 mM HEPES pH7.5, 10 mM EDTA, 2 mM benzamidine, 2 mM DTT), repelleted and resusp- ended in 250 btl of the same buffer. Cells were lysed by freeze-thawing and insoluble cellular material removed by centrifugation. Protein samples were boiled for 1 rain and separated by SDS-PAGE using a 17.5% TRtS-tricine gel as described by Sch/igger and yon Jagow (1987). Proteins were transferred to nitrocellulose membrane (Tow- bin et al. 1979) and probed using anti-Sh.ble antibodies (Cayla, France). Antibody binding was ~isualised using an alkaline phos- phatase assay kit (Bio-Rad) according to the manufacturer's instruc- tions.
Results
Effect of phleomycin on C. reinhardtii
The glycopeptide phleomycin belongs to a family of related antibiotics that act by degrading DNA (Gatig- nol et al. 1988). These antibiotics exhibit activity against a wide range of prokaryotic and eukaryotic organisms and the ble gene from the bacterium S.
hindustanus, encoding a 13.5 kDa phleomycin-binding protein, has been developed as a dominant marker in a number of species (e.g. Jain et al. 1992; Jefferies et al.
1993). The ble gene is particularly attractive as a poten- tial marker in Chlamydomonas, firstly because of its small size (0.4 kb), and secondly because the codon bias in this GC-rich gene is very similar to that found in C.
reinhardtii genes (only three of the codons in bte are rarely used in C. reinhar&ii genes). In order to deter- mine whether ble could be used as a dominant marker in Chlamydomonas, we investigated the effect of phleo- mycin on the wild-type strain CC-125 and the cell-wall- deficient strain CC-278. We found that C. reinhardtii is extremely sensitive to the drug, both in liquid medium and in solid medium, with minimum inhibitory concen- trations (MIC) of approximately 0.02 ~tg/ml and 0.5 btg/ml, respectively. Furthermore, the absence of a cell wall has no effect on the MIC (data not shown).
Transformation rates using homologous markers are currently of the order of 10-s-10 -6. We therefore in- vestigated the incidence of spontaneous resistance to phleomycin in order to determine whether this anti- biotic would be suitable for selection of transformants.
1 x 109 wild-type cells were plated on Pm at a concen- tration of 2 gg/ml. No Pro-resistant colonies were re- covered, indicating that the spontaneous resistance rate is several orders of magnitude below the transforma- tion rates.
Construction of the Prn resistance marker
A number of groups have reported the expression of foreign genes in C. reinhardtii. In each case, the gene has
been linked to its own promoter (Rochaix and van Dillewijn 1982) or to another heterologous promoter such as the nos promoter of Agrobacterium (Hall et al.
1993) or the early promoter of simian virus 40 (Hasnain et al. 1985) and the evidence for expression of these genes has been open to question. Repeated attempts by ourselves to demonstrate expression of foreign genes linked to the cauliflower mosaic virus 35S promoter or to strong promoters from higher plants have been sin- gularly unsuccessful (Day et al. 1990; our unpublished results). Conversely, several groups have successfully used Chlamydomonas promoters to create chimeric Chlamydomonas genes which are expressed in the alga (Davies et al. 1992; Kozminski et aI. 1993; Nelson et al.
1994). We therefore constructed an expression vector (pSP105) based on the C. reinhardtii gene RBCS2, a highly, and constitutively, expressed gene (Gold- schmidt-Clermont and Rahire 1986). Vector pSP105 contains the 5' and 3' untranslated regions of RBCS2 separated by a multiple cloning site, and allows translational fusions of foreign genes at the initiation codon (Fig. 1). The phleomycin resistance gene ble was cloned into pSP105 to create pSP108, in which ble is fused in-frame with RBCS2 (Fig. 1). During the construction, two of the non-optimal codons in ble were changed (TTG to CTG and AGT to AGC) to reflect the codon usage in C. reinhardtii genes (Rochaix 1987). In pSP108 the bte construct is downstream of the lac promoter and we have found that in the presence of IPTG, pSP108 confers phleomycin resist- ance to E. coli at a concentration of 5 btg Pm/ml (data not shown).
Generation of transformants
The ble gene was introduced into the nuclear genome of C. reinhardtii by co-transformation. Strain 363 was transformed with plasmids pSP108 and pARG7.8 (Debuchy et al. 1989) using the glass bead protocol of Kindle (1990). In two separate experiments, 100 Arg ÷ transformants, arising from complementation of the arg7-8 mutation in 363 by the cloned ARG7 gene, were replica-plated to solid medium with or without 2 gg/ml phleomycin to score for transformants expressing the hie gene. In the first experiment, four Pm R clones were identified. In the second experiment, two Pm R clones were recovered. These six transformants were named Pml6, Pml9, Pm21, Pm65, PmT1 and Pro73. The Pm R phenotype of these clones is stable in the absence of selective pressure. They have been maintained on TAP agar plates in the absence of phleomycin for more than 18 months and retain resistance to the drug at 2 btg/ml.
DNA was isolated from the six Pm R transformants and from nine Pm s transformants, as well as from the un- transformed strain. The DNA was digested with EcoRI, fractionated by gel electrophoresis, transferred to a ny- lon membrane and hybridised to a radiolabelled probe
26
• phleomycin sensitive ) 4phieomycin resistantl~
1 2 3 4 5 6 7 8 40 arg 16 19 21 65 71 73 14.9 _
1 . 6 - .," , ' . ' " , ~ ' , .
1 . 1 - ' ' ' ' '., " '
0.54 -
Fig. 2 Southern analysis of DNA extracted from Pm s and Pm R co-transformants and the untransformed strain 363 (arg). DNA was digested with EcoRI and hybridised with a probe for the coding region of ble. The 1.4 kb EcoRI fragment corresponding to the cassette in Fig. 1 is indicated by an arrow. Size markers are in kb
specific for the ble gene. As shown in Fig. 2, the gene is present in all of the Pm R clones and eight of the nine Pms clones, but related DNA is not present in the genome of the untransformed strain. Analysis of addi- tional Pm s clones demonstrated that approximately 80% of Arg ÷ transformants are co-transformants har- bouring ble DNA (data not shown). The RBCS2-ble construct of pSP108 is flanked by EcoRI sites (Fig. 1).
In all of the Pm s co-transformants and four of the six Pm R co-transformants this 1.4 kb EcoRI fragment has remained intact, with one or more copies present in the genome of each clone. In the case of two of the Pm R clones (Pml9 and 73), one or both of the EcoRI sites appear to have been lost during the integration of the marker. Further Southern analysis has confirmed that Pm65 contains only a single copy of ble (data not shown) whereas Pml6, 21 and 71 contain multiple copies of the gene. Since the marker comprises ble flanked by the 5' and 3' regions of RBCS2, we investi- gated whether a gene targeting event had occurred in any of the Pm R or Pm s transformants, such that the endogenous RBCS2 gene had been disrupted. Southern blot analysis revealed that RBCS2 has remained intact in all the transformants (data not shown). This supports previous findings that homologous recombination oc- curs at a very low level in Chlamydomornas and that gene disruption events do not occur readily in this organism (Sodeinde and Kindle 1993; Gumpel et al.
1994).
Expression of ble in P m R transformants
Co-transformation occurs readily in Chlamydomonas, with the frequency of integration of a second unselected gene into the nuclear genome often being as high as 80% (Day et al. 1990; Diener et al. 1990; this work). It is therefore important to demonstrate that the observed phenotype of a transformant arises from the expression of the introduced gene and not from mutation within the transformant population. In order to demonstrate that the ble gene was being expressed in the Pm R transformants we initially looked for ble transcripts by northern blot analysis and RNase protection analysis.
In neither case could transcripts be detected (data not shown). Very low transcript levels for intact and chim- eric transgenes in Chlamydomonas have been reported by various researchers (Kindle et al. 1989; Blankenship and Kindle 1992; Quinn et al. 1993) although the rea- sons for this are unclear. We therefore investigated whether the ble gene product was detectable in our transformants by western analysis using antibodies raised against the bacterial protein. Total soluble pro- tein was extracted from four transformants, the untran- sformed strain and E. coli cells expressing the ble gene carried on plasmid pSP108. The protein extract was fractionated by SDS-PAGE, electroblotted to nitro- cellulose and probed using the antibodies. The results are shown in Fig. 3. The native Sh.Ble protein is a small soluble protein of 13.5 kDa (Dumas et al. 1994).
A single protein band of equivalent size is seen in both the bacterial and transformant extracts, but not in the untransformed Chlamydomonas, despite the similarity in amounts of extract loaded, as evidenced by the free chlorophyll at the bottom of the western blot. Further analysis has shown that the Sh.Ble protein is also detectable in the other two Pm k transformants, but not
E. coli arg7 73 71 65 21
i, i
chl - ~":'~ ? : '
M
r m
kDa 49.5 32.5 27.5 18.5
Fig. 3 Western analysis of four Pm a C. reinhardtii transformants, the untransformed host 363 (arg7) and E. coli, transformed with pSP108 and grown in the presence of IPTG. Total soluble protein was fractionated on a 17.5% denaturing polyacrylamide gel, trans- ferred to nitrocellulose and probed using anti-Sh.Ble antibodies.
Free chlorophyll (chl) and pre-stained markers (M) are indicated
in the Pm s co-transformants containing the ble gene
(data not shown). 1A 1B 2A 2B 3A 3B 4A 4B 5A 5B 5C 6A 7A
Inheritance of the Pm R phenotype
Proof of stable integration and expression of a foreign gene in the nuclear genome of ChIamydomonas requires a clear demonstration of co-segregation of the gene with the phenotype in progeny arising from sexual crosses. We therefore examined the inheritance of hie in the Pm R transformant Pm65(mt-), which contains a single copy of the gene, by mating to a Pm s wild-type strain [either CC-125(mt+) or CC-1021(mt+)]. Re- cently we have found that the 363 strain used as the recipient for transformation carries one or more un- characterised mutations that significantly affect mating efficiency and also prevent the generation of complete tetrads (Gumpel et al. 1995). As a consequence, we were able to obtain only a few progeny representing seven incomplete tetrads. However, these thirteen clones were scored for phleomycin resistance, the presence of a cell- wall, mating type, and arginine requirement. As shown in Table 1, seven of the thirteen are resistant to Pm.
This phenotype is not tightly linked to the other phenotypic markers tested. In order to demonstrate the presence of the ble gene specifically in these seven progeny, DNA was isolated from all thirteen progeny, digested with EcoRI and hybridised to a probe repres- enting the whole of the ble construct, including the RBCS2 sequences. As shown in Fig. 4, the 1.4 kb EcoRI fragment harbouring the construct is present only in
Table 1 Phenotypes of progeny from the Pm65 (mt-) x WT (mt +) cross
Strain Phenotypes a
Pm cw arg mt
WT S + + +
Pro65 R - + -
1A S + + +
1B R - + +
2A S + - -
2B S + + +
3A R - + +
3B R + + -
4A R -- + +
4B S + + -
5A S + + +
5B R -- + +
5C S + - -
6A R + + -
7A R - + ND
a The following traits were scored: sensitivity (S) or resistance (R) to Pm; presence (+) or absence ( - ) of a cell wall (cw); requirement for arginine (arg) in the medium (this phenotypic marker derives from the arg7-8 mutation present in Pm65 but which is masked by complementation with the introduced ARG7 gene); mating type (mt)
+Pm
-Pm
Fig. 4 The co-segregation of bIe and the Pm R phenotype in progeny from a P m 6 5 ( m t - ) x WT(mt+) cross. DNA from the t3 progeny was cut with EcoRI and hybridised to the 1.4 kb EcoRI RBCS2-ble fragment (upper panel). The band corresponding to the endogenous RBCS2 gene present in all the progeny is marked with a diamond.
The RBCS2-ble transgene band derived from Pm65 is marked with an arrow. The presence of this transgene correlates with the Pm R phenotype as confirmed by spot tests on solid medium + / - Pm (lower panels). An additional fragment of RBCS2 (marked with a circle), which is derived from Pro65, does not co-segregate with the Pm R phenotype
those seven progeny capable of growth on Pro. Al- though the number of progeny is low, the data provide firm evidence for the co-segregation of the bIe DNA and the Pm R phenotype.
Since the probe used for the Southern analysis also contains sequence from RBCS2, a high molecular weight band (marked with a diamond in Fig. 4) repres- enting the native RBCS2 gene is also seen in the South- ern blot. An additional band is seen in seven of the progeny (marked with a filled circle) which does not co-segregate with the ble gene. This DNA is not present in the wild-type strains but is present in Pm65 (data not shown) and appears to represent additional RBCS2 DNA derived from the pSP108 plasmid that has integ- rated at a second site unlinked to that of the introduced ble construct.
Direct selection for PmR transformants
Having demonstrated that the RBCS2-ble construct could be expressed in Chlamydomonas to confer Pm resistance, we tested whether this gene could be used as a dominant selectable marker for transformation.
Strain 363 was transformed with pSP108 using the glass bead method of Kindle (1990) but maintaining
28
A1 A2 A3 B1 B2 C1 D1 D2 D3 E1 E2 E3 arg7ble
14.9 - 8.8- 8.4-
4.3- mmm
3.7 - ~,
2.4- 2.2-.
1.9- "
1.6- 1.4- tl~
1.1-
4.~" :v i r
Fig. 5 Southern analysis of DNA extracted from directly selected transformants (A1 E3) and the untransformed strain 363 (arg7).
DNA was digested with EcoRI and hybridised with a probe for the coding region of ble. Size markers are in kb
arginine in the medium throughout. We found that if the cells are transferred onto solid medium containing 2 gg/ml Pm immediately after vortexing with the beads, no Pm R colonies are obtained. However, if the cells are allowed to recover and express the ble gene, by diluting cells in liquid medium and shaking in dim light for 18 hours prior to harvesting and plating on the solid medium, then Pm R colonies appear after 7-9 days.
Typically, 5-10 colonies are obtained per plate. Similar rates were obtained using the Arg ÷ cell wall-deficient mutant CC-2656. To confirm that these colonies were true transformants, Southern blot analysis was carried out on twelve of the 363 colonies picked from five separ- ate plates (A--E). The DNA was digested with EcoRI and probed using the ble DNA as before. As shown in Fig. 5, each transformant contains the ble DNA.
Kindle (1990) has previously demonstrated that glass- bead transformation using the NIT1 marker is dramati- cally improved by the addition of 5% polyethylene glycol (PEG). However, transformation rates using ARG7 were found to be unaffected by PEG (Purton and Rochaix 1995). We therefore examined what effect PEG had on transformation using the ble marker.
Interestingly, we found that PEG had no effect on the transformation rate with CC-2656 (cwa), but had a marked effect on CC-278 (cwl5), improving the rate from only a few transformants to 40-50 transformants per plate. This finding suggests that it is the nature of the cell wall defect that determines whether the addi- tion of PEG is beneficial, rather than the marker used.
Discussion
The development of a reliable and simple nuclear trans- formation system for Chlamydomonas has resulted in
the exploitation of this alga as an excellent model system for molecular genetic studies. A variety of pho- tosynthetic, auxotrophic and motility mutants have been characterised by complementation with cloned wild-type genes (Mayfield and Kindle 1990; Smart and Selman 1993; Debuchy et al. 1989; Kindle et al. 1989;
Diener et al. 1990) and the high rate of transformation now makes possible the cloning of genes by comple- mentation using gene libraries (Purton and Rochaix 1994; Zhang et al. 1994). Furthermore, the high inci- dence of co-transformation allows the efficient intro- duction of unselected genes into Chlamydomonas (e.g.
Mitchell and Kang 1991). Finally, the apparently ran- dom integration of transforming DNA into the nuclear genome provides a simple way of generating 'tagged' mutants in which the affected gene is disrupted by the inserted DNA and therefore amenable to cloning (Tam and Lefebvre 1993; Davies et al.
1994). However, the development of nuclear trans- formation methodology has been hindered by the diffi- culties of expressing foreign genes in Chlamydomonas.
This has limited the repertoire of dominant markers and reporter genes available and prevented the development of suitable markers for gene knockout experiments.
Our demonstration that a bacterial gene can be expressed in Chlamydomonas to provide a stable phe- notype, and that this gene can be used as a dominant selectable marker, confirms that there is no intrinsic bar on the expression of foreign genes. We have shown that if the ble gene is introduced into the genome without selection (i.e. by co-transformation with ARGT) then approximately 3% of the co-transformants ex- press the gene. It is not yet clear whether the silencing of ble in the majority of co-transformants is due to (i) mutations such as small deletions/insertions or re- arrangements within the gene which are not detected by Southern analysis; (ii) insertion of the gene into transcriptionally inactive regions of the chromosomes;
(iii) hypermethylation leading to gene silencing or (iv) a combination of the above, or some other undefined processes. Nonetheless, once a functional copy of ble is established in the nuclear genome it remains functional (even in the absence of selective pressure) through many generations of vegetative growth and after transmission to progeny resulting from sexual crosses.
The expression of ble under the control of the RBCS2 promoter produces a sufficient cellular concentration of the Sh.Ble protein to confer resistance to phleomycin and to be easily detectable using antibodies raised against the bacterial protein. This raises the possibility that Chlamydomonas could be used as a host for the production of recombinant proteins. This is particularly appealing since this unicellular eukaryote is capable of photoautotrophic growth (or heterotrophic growth us- ing the cheap carbon source acetate) and can be readily cultured in large quantity. As noted by Kindle and Sodeinde (1994), it may be possible to further improve
levels of expression by linking the foreign gene to scaf- fold-associated regions, as has been demonstrated in other organisms (e.g. Poljak et al. 1994).
The RBCS2-ble marker has a number of advantages over previously described selectable markers. Firstly, it is considerably smaller than all other available markers - 1.4 kb, compared to 9 kb for NIT1 (Nelson et al. 1994) 7.6 kb for ARG7 (Purton and Rochaix 1995) and 4.5 kb for RBCS2-CRYI-1 (Nelson et al. 1994). It is portable as an EcoRI cassette and, unlike ARG7, it contains no repetitive D N A (Debuchy et al. 1989). These features simplify the design, construction and stability in E. coli of plasmids intended for the introduction of non-selectable genes into Chlamydomonas. Secondly, the ble gene confers phleomycin resistance in both Chlamydomonas and E. coli. Not only is this useful in the construction of ble-containing plasmids, but makes the ble marker a powerful tool for cloning genes by inser- tional mutagenesis. Previous work in several laboratories has shown that tagged mutants can readily be generated using NIT1 or ARG7 (Adam et al. 1993; Tam and Lefebvre
1993; McHugh and Spanier 1994; Gumpel et al. 1995).
However, the vector D N A flanking the marker is often lost or rearranged, thereby preventing the simple isolation of genomic D N A at the integration site by plasmid (or marker) rescue to E. coli (Tam and Lefebvre 1993;
Gumpel and Purton 1994). With the ble marker this problem does not arise since selection for Pm R Chlamydomonas transformants ensures that the marker is intact and able to act as a selectable marker for D N A recovered to E. coll. Thirdly, the protocol for direct selec- tion of Pm R transformants using RBCS2-ble is somewhat simpler than that for direct selection of emetine-resistant transformants using RBCS2-CRYI-1. The latter involves inducing gametogenesis in transformed cells, culturing the gametes for 4 days and then allowing them to dedifferenti- ate back to vegetative cells prior to applying drug selec- tion (Nelson et al. 1994). In our protocol, transformed cells are allowed to recover and express the ble gene by growing them in liquid medium for 18 h prior to selection on Pro-containing solid medium.
The development of the RBCS2-ble marker illustrates that foreign gene expression is feasible in Chlamy- domonas and extends the repertoire of markers avail- able for transformation. We are currently exploring various parameters which may increase the numbers of transformants that can be recovered, and the level of ble expression.
Acknowledgements This work was supported by a studentship to DRS from the Agricultural and Food Research Council and grant 31.26345.89 from the Swiss National Foundation.
References
Adam M, Lentz KE, Loppes R (1993) Insertional mutagenesis to isolate acetate-requiring mutants in Chlamydomonas reinhardtii.
FEMS Microbiol Lett 110:265-268
Blankenship JE, Kindle KL (1992) Expression of chimeric genes by the light-regulated cablI-1 promoter in Chlamydomonas reinhardtii: A cablI-I/nitl gene functions as a dominant selectable marker in a nitl- nit2- strain. Mol Cell Biol 12 : 5268-5279
Bingham SE, Cox JC, Strem MD (1989) Expression of foreign DNA in Chlamydomonas reinhardtii. FEMS Microbiol Lett 65 : 77-82
Davies JP, Weeks DP, Grossman AR (1992) Expression of the arylsulfatase gene from the flz-tubulin promoter in Chlamy- domonas reinhardtii. Nucleic Acids Res 20 : 2959-2965
Davies JP, Yildiz F, Grossman AR (1994) Mutants of Chlamy- domonas with aberrant responses to sulfur deprivation. Plant Cell 6 : 53-63
Day A, Debuchy R, van Dillewjin J, Purton S, Rochaix J-D (1990) Studies on the maintenance and expression of cloned DNA fragments in the nuclear genome of the green alga Chlamy- domonas reinhardtii. Physiol Plant 78 : 254-260
Debuchy R, Purton S, Rochaix J-D (1989) The argininosucci- nate lyase gene of Chlamydomonas reinhardtii: an important tool for nuclear transformation and for correlating the genetic and molecular maps of the ARG7 locus. EMBO J 8 : 2803-2809
Diener DR, Curry AM, Johnson KA, Williams BD, Lefebvre PA, Kindle KL, Rosenbaum JL (1990) Rescue of a paralyzed-flagella mutant of Chlamydomonas by transformation. Proc Natl Acad Sci USA 87 : 5739-5743
Drocourt D, Calmels T, Reynes JP, Baron M, Tiraby G (1990) Cassettes of the Streptoalloteichus hindustanus ble gene for trans- formation of lower and higher eukaryotes. Nucleic Acids Res 18 : 4009
Dumas P, Bergdoll M, Cagnon C, Masson J-M (1994) Crystal structure and site-directed mutagenesis of a Neomycin resistance protein and their significance for drug sequestering. EMBO J 13 : 2483 2492
Feinberg AP, Vogelstein B (1984) A technique for radiolabeling DNA restriction nuclease fragments to high specific activity.
(Addendum). Anal Biochem 137:266-267
Gatignol A, Durand H, Tiraby G (1988) Bteomycin resistance con- ferred by a drug-binding protein. FEBS Lett 230 : 171-175 Goldschmidt-Clermont M, Rahire (1986) Sequence, evolution and
differential expression of the two genes encoding variant small subunits of ribulose bisphosphate carboxylase/oxygenase in Chlamydomonas reinhardtii. J Mol Biol 191:421-432
Gorman DS, Levine RP (1965) Cytochromefand plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 54:
1665-1669
Gumpel NJ, Purton S (1994) Playing tag with Chlamydomonas.
Trends Cell Biol 4:299-301
Gumpel NJ, Rochaix J-D, Purton S (1994) Studies on homologous recombination in the nucleus of Chlamydomonas reinhardtii. Curr Genet 26 : 438-442
Gumpel N J, Ralley L, Girard-Bascou J, Wollman F-A, Nugent JHA, Purton S (1995) Nuclear mutants of Chlamydomonas reinhardtii defective in the biogenesis of the cytochrome b6 fcomplex. Plant Mol Biol 29 : 921 932
Hall LM, Taylor KB, Jones DD (1993) Expression of a foreign gene in Chlamydomonas reinhardtii. Gene 124:75-81
Harris EH (1989) The Chlamydomonas sourcebook: a comprehen- sive guide to biology and laboratory use. Academic Press, San Diego
Hasnain SE, Manavathu EK, Leung W-C (1985) DNA-mediated transformation of Chlamydomonas reinhardtii cells: use of amino- glycoside 3'-phosphotransferase as a selectable marker. Mol Cell Biol 5 : 3647-3650
Jain S, Durand H, Tiraby G (1992) Development of a transformation system for the thermophilic fungus Talaromyces sp. CL240 based on the use of phleomycin resistance as a dominant selectable marker. Mol Gen Genet 234:489-493
30
Jefferies D, Tebabi P, Le Ray D, Pays E (1993) The ble resistance gene as a new selectable marker for Trypanosoma brucei: fly transmission of stable procyclic transformants to produce anti- biotic-resistant bloodstream forms. Nucleic Acids Res 21:
191-195
Kindle KL (1990) High-frequency nuclear transformation of Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 87:
1228-1232
Kindle KL, Sodeinde OA (1994) Nuclear and chloroplast trans- formation in Chlamydomonas reinhardtii: strategies for genetic manipulation and gene expression. J Appl Phycol 6 : 231-238
Kindle KL, Schnell RA, Fernandez E, Lefebvre PA (1989) Stable nuclear transformation of Chtamydomonas using the Chlamydo- monas gene for nitrate reductase. J Cell Biol 109:2589-2601 Kozminski KG, Diener DR, Rosenbaum JL (1993) High level ex-
pression of nonacetylatable ~x-tubulin in ChIamydomonas reinhar- dtii. Cell Motil Cytoskeleton 25 : 158-170
Mayfield SP, Kindle KL (1990) Stable nuclear transformation of Chlamydomonas reinhardtii by using a C. reinhardtii gene as the selectable marker. Proc Natl Acad Sci USA 87:2087-2091 McHugh JP, Spanier JG (1994) Isolation of cadmium-sensitive mu-
tants in Chlamydomonas reinhardtii by transformation/inser- tional mutagenesis. FEMS Micro Lett 124:239-244
Mitchell DR, Kang Y (1991) Identification of oda6 as a ChIamy- domonas dynein mutant by rescue with the wild-type gene. J Cell Biol 113:835-842
Nelson JAE, Savereide PB, Lefebvre PA (1994) The CRY1 gene in Chlamydomonas reinhardtii: structure and use as a dominant selectable marker for nuclear transformation. Mol Cell Biol 14:4011-4019
Poljak L, Seum C, Mattioni T, Laemmli UK (1994) SARs stimulate but do not confer position-independent gene expression. Nucl Acids Res 22 : 4386-4394
Purton S, Rochaix J-D (1994) Complementation of a Chlamy- domonas reinhardtii mutant using a genomic cosmid library.
Plant Mol Biol 24:533-537
Purton S, Rochaix J-D (1995) Characterization of the ARG7 gene of Chlamydomonas reinhardtii and its application to nuclear trans- formation. Eur J Phycol 30:141-148
Quinn J, Li HH, Singer J, Morimoto B, Mets L, Kindle K, Merchant S (1993) The plastocyanin-deficient phenotype of Chlamy- domonas reinhardtii Ac-208 results from a frameshift mutation in the nuclear gene encoding apopreplastocyanin. J Biol Chem 268 : 7832-7841
Rochaix J-D (1987) Molecular genetics of chloroplasts and mitochondria in the unicellular green alga ChIamydomonas.
FEMS Microbiol Rev 46 : 13-34
Rochaix J-D, van Dillewijn J (1982) Transformation of the green alga Chlamydomonas reinhardtii with yeast DNA. Nature 296:
70-72
Rochaix J-D, Mayfield S, Goldschmidt-Clermont M, Erickson J (1988) Molecular biology of Chlamydomonas. In: Schaw C-H (ed) Plant Molecular Biology: A Practical Approach. IRL Press, Oxford
Sambrook J, Friseh EF, Maniatis T (1989) Molecular cloning: a la- boratory manual (2rid edn). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York
Sch/igger H, yon Jagow G (1987) Tricine-sodium dodecyl sulphate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1-100 kDa. Anal Biochem 166: 368-379 Smart E J, Selman BR (1993) Complementation of a Chlamydomonas
reinhardtii mutant defective in the nuclear gene encoding the chloroplast coupling factor 1 (CF1) y-subunit (atpC). J Bioenerg Biomemb 3 : 275-284
Sodeinde OA, Kindle KL (1993) Homologous recombination in the nuclear genome of Chlamydomonas reinhardtii. Proc Natl Acad Sci USA 90:9199-9203
Stevens DR, Purton S (1994) Expression of foreign genes in the green alga Chlamydomonas reinhardtii. J Exp Bot 45 (Suppl) : 20 Tam LW, Lefebvre PA (1993) Cloning of flagellar genes in
Chlamydomonas reinhardtii by DNA insertional mutagenesis.
Genetics 135 : 375-384
Towbin H, Staehelin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: pro- cedure and some applications. Proc Natl Acad Sci USA 76:4350-4354
Zhang H, Herman PL, Weeks DP (1994) Gene isolation through genomic complementation using an indexed library of Chlamy- dornonas reinhardtii DNA. Plant Mol Biol 24 : 663-672