Article
Reference
Extensive Regions of Homology in Front of the Two hsp70 Heat Shock Variant Genes in Drosophila melanogaster
KARCH, François, TÖRÖK, Istvan, TISSIERES, Alfred
Abstract
The major heat shock protein of 70,000 Mr in Drosophila melanogaster is encoded by two variant gene types located, respectively, at the chromosomal sites 87A7 and 87C1. We present the DNA sequence of a complete hsp70† gene of the 87A7 type and of the adjacent regions from both variants, extending to 1·2×10³ bases upstream from the start of the messenger coding region. We find an untranslated region of 250 nucleotides at the 5′ end of the messenger coding sequence in both variants. There is only one open reading frame which allows coding of a 70,000 Mr protein within the 87A7 variant, as found for an 87C1 variant (Ingolia et al., 1980). We observe 4·2% nucleotide divergence between these two variants with complete conservation of the reading frame. There is a conserved sequence of 355 nucleotides in front of each hsp70 gene, which is 85% homologous between the two variants.
The presence of the same sequence element in γ, in front of the αβ heat shock genes (R. W.
Hackett & J. T. Lis, personal communication) suggests that this element contains the regulatory signals for the coordinate expression of both the hsp70 [...]
KARCH, François, TÖRÖK, Istvan, TISSIERES, Alfred. Extensive Regions of Homology in Front of the Two hsp70 Heat Shock Variant Genes in Drosophila melanogaster . Journal of
Molecular Biology , 1981, vol. 148, no. 3, p. 219-230
DOI : 10.1016/0022-2836(81)90536-2
Available at:
http://archive-ouverte.unige.ch/unige:150454
Disclaimer: layout of this document may differ from the published version.
1 / 1
J. Mol. Biol. (1981) 148,219-230
Extensive Regions of Homology in Front of the Two hsp70 Heat Shock Variant Genes
in Drosophila melanogaster
FRANCJOB KARCH’, ISTVAN TUROK’ AND ALFRED TISSIBRES’
‘Department of Molecular Biology, TJniversity of Geneva 30, quai Ernest-Ansermet, 1211 Geneva 4, Switzerland
‘Institute of Genetics, Biological Research Center,
Hwngarian Acudemy of Sciences P.O. Box 521, 6701 Szeged, Hungary (Received 18 February 1981)
The major heat shock protein of 70,006 M, in Drosophila melanogaster is encoded by two variant gene types located, respectively, at the chromosomal sites 8787 and 87Cl. We present the DNA sequence of a complete hsp70t gene of the 87A7 type and of the adjacent regions from both variants, extending to 1.2 x 10’ bases upstream from the start of the messenger coding region. We find an untranslated region of 250 nucleotides at the 5’ end of the messenger coding sequence in both variants. There is only one open reading frame which allows coding of a 70,000 M, protein within the 8787 variant, as found for an 87Cl variant (Ingolia et al., 1980).
We observe 4.2?6 nucleotide divergence between these two variants with complete conservation of the reading frame. There is a conserved sequence of 355 nucleotides in front of each hap70 gene, which is 85% homologous between the two variants.
The presence of the same sequence element in y, in front of the @ heat shock genes (R. W. Hackett & J. T. Lis, personal communication) suggests that this element contains the regulatory signals for the coordinate expression of both the hsp70 and the + heat shock genes. Finally we find a very A+T-rich sequence of 150 base- pairs which is highly conserved (91.87;) @6 x lo3 bases upstream from two hps70 gene variants.
1. Introduction
When Drosophila melanogaster is exposed to 37”C, a set of nine specific puffs is induced while most of the other puffs, active before the heat shock, regress (Ritossa.
1962). New messenger RNAs appear very rapidly in polysomes and are translated into a few characteristic polypeptides, the heat shock proteins (Tissibres et al., 1974:
McKenzie et al., 1975), while the genes previously active are repressed (for a review, see Ashburner & Bonner, 1979). Genes coding for the major heat-induced polypeptide, the 70,000 M, heat shock protein, have been isolated and their organization studied (Livak et al., 1978; Schedl et al., 1978; Artavanis-Tsakonas et al., 1979: Craig et al., 1979; Holmgren et al., 1979; Morgan et al., 1979; Goldschmidt- Clermont, 1980). There are five to six copies of the hsp7Ot genes per haploid genome
t Abbreviation used: hsp70, the 70,000 AI, heat shock protein.
219
oozz-2836/81/150219-12 $02.00/0 CQ 1981 Amdemic Press Inc. (Lontlon) Ltti
220 F. KARCH, I. TdRiiK AND A. TISSIfiRES
(Mirault et al., 1979). These genes are present as two variants, each one originating from one of two sites on the chromosomes, 8787 and 87C1, respectively (Ish- Horowitz et al., 1979; Ish-Horowitz & Pinchin, 1980). In most strains two copies of these genes are arranged as an inverted repeat at 8787 (Goldschmidt-Clermont, 1980). At 87Cl two tandem repeats of the hsp70 genes are separated by a segment of about 39 x IO3 bases from a single additional copy in the opposite orientation. In this 39 x IO3 base segment lie the $3 heat shock genes (Lis et al., 1978 ; Ish-Horowitz
& Pinchin, 1980). The basic conserved unit Z consists of a segment Z, (Z coding, 2.2 x IO3 bases), which is complementary to the hsp70 mRNA, and is preceded by a segment Z,, (Z non-coding, 0.3 x IO3 bases) not represented in the mRNA (Artavanis-Tsakonas et al., 1979). The detailed analysis of the two hybrid plasmid 56H8 and 13233 carrying, respectively, one and two copies in tandem of the hsp70 genes has revealed an additional region of homology, X (0.2 x IO3 bases), upstream from Z and separated from it by a divergent region Y (02 x IO3 bases) (Morgan et al., 1979). Although the hsp70 genes have similar structures in 56H8 and 13233, the restriction maps show small but characteristic differences in their organization and adjacent sequences, corresponding to the two variants. 56H8 is derived from 8787 and 13233 from 87Cl (Ish-Horowitz et al., 1979). Here we report DNA sequences of the regions surrounding the two hsp70 genes in 13233, including the spacer. A detailed comparison with the other hsp70 gene variant in 56H8 (Tijrijk & Karch, 1980) allows determination of the extent and the structure of the homologous regions (see above). We also report the complete DNA sequence of Z, in 56H8 and compare the amino acid sequence of the 8787 hsp70 variant with that of 87Cl hsp70 recently published by Ingolia et al. (1980).
2. Materials and Methods (a) Enzymes and DNA
Plasmid DNA was prepared as described previously (Artavanis-Tsakonas et al., 1979;
Moran et al., 1979) and further purified by sucrose gradient centrifugation. Restriction enzymes were obtained from New England Biolabs, Inc. (Beverly, Mass.). We used the buffers recommended by the manufacturers. Alkaline phosphatase from calf intestine was supplied by Bohringer Mannheim and used as previously reported (Torijk & Karch, 1980). T4 polynucleotide kinase was purchased from Miles and [Y-~~P]ATP from New England Nuclear.
(b) Preparation of DNA fragments
We present in Fig. 1 the DNA sequencing strategy and the different subclones used for the isolation of the fragments. The BamHI fragment carried by B3U was inserted at the BamHI site of pBR313 (L. Morran, unpublished work), the BgZII-BamHI fragment contained in 51 is inserted in the BamHI site of pBR322, the &HI-XhoI fragment takes the place of the small BamHI-Sal1 fragment in pBR322. In order to complete the sequences in the coding region of 56H8 we used a subclone containing the Sa21 fragment (see Fig. 1) inserted at the SaJI site of pBB322. The 3 latter subclones were kindly provided by M. E. Mirault and P. Bchedl. In general we applied the same procedure to isolate and kinase the DNA fragments as previously described (Tiirok & Karch, 1980).
EXTENSIVE HOMOLOGIES PRECEDE hap70 GENES (c) DNA sequencing
261
The chemical method of Maxam & Gilbert (1977) was used as described (Maxam & Gilbert, 1980). At the end of the procedure the samples were resuspended without NaOH in the sample buffer and boiled for 1 min at 100°C before loading on the gel. We used 2Oyc thin sequencing gels (Maxam & Gilbert, 1977) and thin 8% sequencing gels (Sanger & Coulson, 1978). With this procedure it is possible to read the first 100 nucleotides of a fragment with 99Oi, accuracy. For the next 100 nucleotides both strands were always sequenced in order to reach the same precision. The regions sequenced by both Ingolia et al. (1980) and ourselves are in good agreement. We observed only few base substitutions downstream from the first hsp70 gene contained in 13233 and G3. DNA sequence analyses were carried out on a HewletePackard computer, model 9845.
3. Results
(a) Comparison of the different regiow of homology in hsp70 genes
Restriction maps of 13233, DNA sequence strategy and the different subclones used to isolate the fragments are shown in Figure 1 (see also Materials and Methods). At the 5’ end of the first 13233 gene we have sequenced 1280 base-pairs upstream from the start of the coding region. This includes the entire X, Y and Z,, elements and extends 280 nucleotides into Z, (Fig. 3). Moreover, starting 390 base- pairs upstream from the end of the first coding region in 13233, 1750 nucleotides were sequenced covering the entire spacer between the two genes, Z,, and 280 base- pairs into the second Z, region (Figs 2 and 3).
The comparison of the sequences in both hsp70 genes of 13233 and of its variant in 56H8 allows precise assignment of the limits of the different regions of homology previously noted by cross-hybridization and heteroduplex analysis (Moran et al., 1979; Artavanis-Tsakonas et al., 1979; Goldschmidt-Clermont, 1980). To this end, in addition to the sequences already published (Tiirijk & Karch, 1980), we have sequenced the complete messenger coding region between the two Sal1 sites in 56H8 (Figs 1 and 2).
(b) The region complementary to the hsp70 mRNA, 2,
The 5’ end of the hsp70 mRNA is assigned to position 1 f. 2 by analogy with 56H8 (Tiirijk & Karch, 1980). There is only one open reading frame within the coding region of 56H8 that is large enough to code for a 70,000 M, protein (Fig. 2). The translation would start at the first A-T-G triplet found in Z, at position 252 (Fig. 3) and stop 1929 nucleotides further downstream three bases after the Sal1 site (Figs 1 and 2). There is 4.2o/b nucleotide divergence with the coding region of the other variant type contained in G3 (Ingolia et al., 1980) with complete conservation of the reading frame. Most of the base substitutions occur in the third position of the triplets (Fig. 2). Out of 643 amino acids, there would be 16 substitutions, and two insertions. At the beginning of the gene in 56H8 we observe an additional alanine (position 634 in Fig. 2) and at the end an additional glycine (position 2095 in Fig. 2). Half of the amino acid substitutions between the two variants occur in the last 100 amino acids at the C terminus. The remaining substitutions are regularly distributed along the protein sequence. As pointed out by Ingolia et al. (1980), this
F. KARCH, I. TORiiK AND A. TISSIfiRES
0 1000 2000 3000 4000 5000 6000 7000 I
0 200 400 600 800 1000 1200 1400 1600 I800 2000 2200
FIG. 1. Restriction maps of 13233 and 56H8 showing the sequencing strategy. The positions of the elements X, Z,, and the 5’ end of the region complementary to the hsp70 mRNA Z, were established following the sequence data. The arrow under Z, indicates t,he direction of transcription. The 3 lower maps show the subclones used, SalI-Sal1 for 56H8, as well as 51 and B3U for 132E3 as located by thin lines above the 132E3 map (see Materials and Methods). The short arrows indicate the restriction site origin, the direction and the extent of the DNA sequence determination.
postulated amino acid sequence is not homologous to any known protein sequence.
After the termination triplet the nucleotide sequence of the two variants diverges completely. In the first 13233 repeat, we have sequenced a fragment of 200 base- pairs downstream from the postulated initiation triplet and a fragment of 390 base- pairs upstream from the termination triplet. These two sequences are lOOo/;, homologous to the corresponding sequences in G3.
1650
2050 2150
Rc:. 2. Complete nurleotide sequence of the largest open reading frame within the 8787 hxp70 gene of 56HS. The nucleotide sequence corresponds to the non-coding strand and starts at the first ATG codon in Z,. The restriction sites of several relevant enzymes are indicated. Only the ba.se substitutions and the amino acid substitutions in the 87C1 variant of G3 are indicated under the sequence (Ingolia et al., 1980). We noted a few mistakes in the previously published 56H8 sequences (TGrijk & Karch, 1960) and the newly correrted data are presented above and in Fig. 3. The hyphens have been omitted for clarity.
224 F. KARCH, I. T6R6K AND A. TISSIKRES
At the 5’ end of Z, there is a long untranslated region of 250 nucleotides, which is lOOo/;, homolog ous in both repeats of 132E3 as well as in the first 03 hsp70 gene (Ingolia et al., 1980). However, we observe 12-47; divergence with the corresponding region in the other variant in 56H8 caused by base substitutions, small insertions and deletions (Fig. 3). Moreover, we found a number of termination triplets. These observations make it very unlikely that these sequences could be translated. There is so far no evidence for intervening sequences within hap70 genes in agreement with Holmgren et al. (1979).
In the 3’ untranslated region of the first 13233 hsp70 gene, we have found the A-A-T-A-A-A sequence that is common to several eukaryotic poly(A)+ mRNAs 14 to 30 bases upstream from the poly(A) tail (Proudfoot & Brownlee, 1976;
Efstratiadis et al., 1980). The same motif is present in the 56H8 hsp70 gene but in a different position relative to the termination triplet (Fig. 4; Tiirijk & Karch, 1980).
Since the two sequences diverge completely downstream from the termination triplet, the 3’ end of the hsp70 mRNA should be heterogeneous. Preliminary data by S, mapping (our unpublished results) have indeed shown three possible 3’ ends of the hsp70 mRNA between position - 1000 and -980 (Fig. 4).
(c) G3 a conserved sequence in front of the hsp70 genes not represented in the messengers
In the homologous regions Z,, in the two variants, which extend from position - 1 to -355 (Fig. 3), we observe 15% divergence due to base substitutions, insertions and deletions. In particular, there is a deletion of 15 bases at position -262 in both 13233 repeats which removes the second T-A-T-A-A-A-T-A motif observed in 56H8 (see also TBriik & Karch, 1980). The Z,, element of both 13233 repeats extends a little upstream to position -388 (Fig. 3). The divergence observed is about 2% and involves only base substitutions. Interestingly the Z,, elements of the two first repeats in G3 are lOOo/o homologous (Ingolia et al., 1980) to the corresponding Z,, elements of 13233, so that the same base substitutions occur.
The homology between both 13233 repeats extends upstream from Z,, to position -590 and involves some deletion in the second repeat. One deletion of 25 bases occurs at the left border of Z,, in the second repeat (Fig. 3). A similar region of homology exists also in front of the C$ heat shock genes, in the so-called y sequence (Lis et al., 1978,1981). This region matches more closely with the 13233 Z,, sequence (97.5%) than with that in 56H8 (83.2%) (see R. W. Hackett & J. T. Lis, unpublished results).
FIG. 3. Comparison of the DNA sequences preceding the hsp70 genes in 132E3 and in 56H8 The nucleotide sequence presented corresponds to the non-coding strand of the 87Cl variant in the first 132E3 repeat. The homologous sequences in the second 13233 repeat and in the 8787 variant of 56H8 are shown in the frames, respectively, above and under the sequence, whereby only base substitutions, deletions or insertions relative to the first 132E3 repeat are indicated. The deletions are represented by hatched blocks. The hsp70 mRNA starts at position 1 f 2 (Tijrijk & Karch, 1980). Since these sequences are aligned to show the maximum homology, the numbering does not actually reflect the real position in each individual sequence. The T-A-T-A-A-A-T-A motif and the first ATG triplet are pointed out by thick lines. The arrows locate the direct repeats mentioned in the text. The hyphens have been omitted for clarity.
I270 1260 -1250 -1210 -1230 -1220 1210 -1200 ~1190 4lSO
CGCCCCCTCAGAGTCCTGACCTTAACCCCTTGAAAI\TTCGTAGACCTACTTAAAGAAGMGGTGGC~~AGGGCCCTACAACACGACAAACCTTATGAC
4170 -1160 -“:” m= ~1110 __--- , , , , , ( -1120 -410 -1100 1090 lo80
TGCAATAGTCAAATAGTGGAAAGATGCCAAGATCTTGAATATGACCTACMAAACGTAACCATTCCATAAAAAU\GTCTCCAACTCGTAGACAAAGTC
-1070 -1060 1050 40‘0 -1030 -1020 -1010 -1000 -990 -980
AATGAGGAACATACTAC6TACTAAAACTTTTAAAATTTTAATTAAATAATTTAAAATTTTAGGATTAAGTTTC
-910 -960 -950 -WI -930 -920 -910 -900 - 890 880
TTGACAGTCTCAAAAGTGTGTAAAC;TCCAATTTGTGGTTTATTTTCTTGT~T~TTAATATTTT~AATTTATTTTTTGATTTATAAGT~~T~ATAT
-870 -850 -850 -8‘0 -830 - BZO -810 800 -790 -780
TGTTTAATTATATTTTATAAAATTGcGTTT~TTMG~~AACCCTTAATTTTTAGcTAGCTTTAAA6TtAAAAATTATTTCAC~GTGT
-770 -760 -750 -7‘0 -730 -120 -710 -700 -690 680
GTRIUICAGTTTCTTGACAAACT~~T~TATTTTTTTTC
m -G
-670 -660 -650 -6‘0 -630 -620 -610 -600 -590 -580
CGTTTAATTAAGcAAATAACCCTTAATTTTTACCT;TAAP
IGIAZCEG CB1AZT-
-570 - 560 -550 -5‘0 -530 -520 -510 -500 -I.90 -LB0
ATGTATGTAAATATGTiAAATAAGTChACTAAATkTAATACA !%i:hkTtTTMATTAAfTTTAiATTA 4 I
-L70 460 450 ma = -T--- 430 420
.400 390 -380 I 1
AAACAIXAGAAAGTC;GTTAAT~GTTGATTTC!I I
ETTTAG*&xA
-370 -360 -350 -3‘0 -310 -320 -310 -300 -290 -280
l&E
GG&TACbCA+cA44~c~CT~cGATTATC~ TTAlllAAGc~GCCGTATTTiTAGAAAT~TCcAAAATAiAG~~
Zd;AIC -
-270 -260 Xba --- -2‘0 -230 -220 -210 -200 xho ___--
I -70 -60 -50 40 -30 -20 -10 1 IO 20
CCACLMGCGCGCCT;GMTGTCG~G~~~GC~CCG~GTAT~TAGAGGC~C~CGTC~A~GGAGCGA~~TTC~TTC~~AG~GTG~ I IZ.XTI
130 I‘0 150 160 170 880 190 200 210 220
CTGcAACTkTGAAATCT ’ CLWAGTjATTATTGAA@cAW&bUCT Wi ACTTTCMChGTi d- --
230 2‘0 250 1 260 270 280
f @~J~~GAACTCAOKXAATGCCTGCTA~TGGAATCGA~TGGG~ACC~~
FIG. 3.
226 F. KARCH, I. TiiKijK AND A. TISSIBRES
=o, -1100
mm-e--
AC?C?G6A~CCPCAPt,~G~AG~TC,~C~AGCC~ATAG~T~ATTCAGTTC~GGCTTAAGT~T~T~~GT~ATATTATTT~TTTGG~GT~CC AACCAA~GnnTGT~TAACT~TA~ATAATTATG~TAGTTTTAA~TTAGC~C~TTGATTTT~GCTAT~~~~CTACTTGGT~~T~~~TA
BpJlx TATTTAiTTAAAGATAi\TTGCGTTTTiATTGTCAGCtAC~TTTAAATGC~ATG
-800
FIG. 4. Nucleotide sequence of the 13233 spacer. The nucleotide sequence starts 29 nucleotides upstream from the termination triplet of the first 13233 gene. The continuation of the base sequence, corresponding to the duplicated region of 13233 is shown in Fig. 3 starting from position -586, upper line. Thus the numbering corresponds to that of Fig. 3. The termination triplet and the A-A-T-A-A-A motif are shown by thick lines. The restriction sites of some relevant enzymes are indicated. The hyphens have been omitted for clarity.
(d) A very A +T-rich sequence conserved in front of two hsp70 genes
In front of the first 13233 gene, in the region corresponding to X, we find an A+T-rich stretch of 150 bases, from position -753 to -603, of which 140 are homologous to an A+T-rich segment at the same position in 56H8 (Fig. 3). This observation confirms the suspicion that this A + T-rich region is characteristic of the X element (TBrijk & Karch, 1980). Interestingly, the X sequence appears to be directly duplicated in front of the first 13233 gene, since it is also found from position -922 to -772. In front of the second gene, however, we find no sequence correspondirig to X, confirming the data of Goldschmidt-Clermont (1980).
Moreover, we assume that this sequence homology corresponds to X, described by Goldschmidt-Clermont (1980).
4. Discussion
(a) Sequences of hsp70 genes
The genes for the major heat shock protein of 70,000 M, are present as two variants, each originating from one of two sites on the chromosomes, 8787 and 87Cl (Ish-Horowitz wt al., 1979). The D. melanoguster DNA insert in plasmid 13233 contains two hsp70 genes from site 87Cl arranged in tandem. We have sequenced a region upstream from the first gene which contains the elements X and Z,, homologous to similar elements in front of other hsp70 genes (Moran et al., 1979 ; Artavanis-Tsakonas et al., 1979) ; the beginning and the end of the first hsp70 coding sequence Z,, the spacer between the two repeated genes, the element Z,, and the beginning bf Z, in the second repeat (see Introduction for a definition of the sequence elements X, Y, Z,, and Z,). Similar analysis of the other hsp70 gene variant in 56H8, originating from site 8787, have been reported (T&Sk t Karch, 1980) and recently, Ingolia et al. (1980) have published the complete primary sequence of one hsp70 gene contained in the hybrid plaemid G3.
EXTENSIVE HOMOLOGIES PRECEDE hap70 GENES
(b) l%e coding region
227
There is only one open reading frame within Z, that can code for a 70,000 M, protein (see Fig. 2 and Ingolia et al., 1980). The 4.2”/b divergence observed between Zc sequences of both variants does not involve any change in the reading frames between the first ATG codon and the termination triplet. However, upstream from this first ATG codon, the sequences diverge by 12% and now the reading frames are upset. It is therefore likely that the translation of the hsp70 gene starts at the first ATG in Z,. Downstream from the termination triplet, the sequences begin t’o diverge while the A + T content increases (Fig. 2). We find that the codons are used in the same non-random fashion as observed for several genes from different organisms (Russel et al., 1976: Efstatiadis et al., 1977; Schaffner et al., 1978; Kedes.
1979; Goldberg, 1979). Most of the base substitutions between the two variants are silent and the amino acid sequences diverge only by 2.70/o. While the function of the 70,000 M, heat shock protein is as yet unknown, the high degree of conservation of the amino acid sequence of both variants suggests that the genes coding for this protein undergo selective pressure and may be functional in conditions other than heat shock.
(c) Possible sequences controlling the expression of the hsp70 genes
There are two regions of homology in front of the hsp70 genes, namely X and Z,, (Moran et al., 1979) which could play a role in the rapid and coordinate expression of these genes.
We find that the 150 base-pair sequence element X, corresponding to X, (Goldschmidt-Clermont, 1980), present in front of the first gene in 13233 and in 56H8 is very A+T-rich (92%) and highly conserved (91%). Wu (1980) has shown that the hsp70 genes in Drosophila are hypersensitive to DNAase I at their 5’ ends.
One of these sensitive hot spots occurs within the X, element. These regions could reflect a particular nucleosome arrangement making the DNA more accessible for regulatory factors. Our sequence data clearly show that no such X, element exists in front of the second gene in 13233, in contrast to previous reports (Moran et al., 1979), and it would be interesting to know if this second gene can be active.
Whether this type of A + T-rich sequence conserved in front of two related genes has a particular function remains to be investigated. It should be noted that using specific probes containing X, it is found that they hybridized in, situ to a number of sites other than 8787 and 87Cl (Lis et al., 1981), suggesting that X sequences are distributed in other parts of the Drosophila genome. Another DNAase I-sensitive hot spot suggesting a particular nucleosome arrangement occurs within Z,, (Wu.
1980). The Z,, sequences are located only at 8787 and 87Cl (Lis et al., 1981) and. in contrast to X, are adjacent to all hsp70 genes (Mirault et al., 1979; Ish-Horowitz et aZ., 1979) and to the a/3 heat shock genes at 87C1 within the y element, (Lis et al..
1978). Indeed, analysis of a deficiency suggests that X is not essential for the heat induction of the hsp70 genes. This deletion removes the region upstream from Z., including X, apparently without affecting the hsp70 heat induction (Udvardy et al..
unpublished results). In another strain a deletion removes the 3’ half of one
228 F. KARCH, I. TiiRijK AND A. TISSI&RES
hsp70 gene, leaving a partial gene coding for a 40,000 M, polypeptide after heat shock (Caggese et al., 1979). This indicates that the second half of the gene is not required for the heat induction. These observations and the finding that y contains a complete Z,, sequence plus the first 64 nucleotides of Z, (R. W. Hackett & J. T.
Lis, unpublished results) suggests that the regulatory region of both the hsp70 and the tip heat shock genes lies within Z,, and the beginning of Z,.
(d) Properties of Z,,
In the two 13233 repeats both Z,, elements are highly conserved. We observe 2%
divergence and precisely the same divergence is found in the first two repeats in the hybrid plasmid G3 (Ingolia et al., 1980), probably reflecting a “recent” gene duplication event at 87Cl. On the other hand, there is about 15% divergence between Z,, in the two variants (56H8 versus 13233). Comparison of Z,, in 56H8 with the corresponding element in G13 also derived from 87A7 (Ingolia et al., 1980) reveals 2.80/b divergence involving only base substitutions. Taking the 13233 Z,, sequence as the prototype, a particular deviation, a small insert of 15 bases, occurs at position -265 in 56H8 as well as in G13. This small insertion, which contains the second T-A-T-A-A-A-T-A motif observed in 56H8 (TiirBk & Karch, 1980), is also absent in yz at 87Cl (R. W. Hackett & J. T. Lis, unpublished results). However, this small insert does not seem to reflect a characteristic feature of the 87A7 Z,, sequences, since it is also absent in front of the remaining active hsp70 gene at 8787 in the strain Sze-13 (Udvardy, personal communication). There is a direct repeat of eight bases at the border of this small insert, of which five are part of the second T-A-T-A-A-A-T-A motif in 56H8 (Fig. 3). Other investigations have shown that the T-A-T-A-A-A-T-A motif occurs at positions likely to have been involved in recombinational events in Drosophila histone genes (Goldberg, 1979). The overall high conservation of Z,, sequences suggests that the entire element is involved in the regulation of the expression of the hsp70 and the afl heat shock genes. In this view the small divergence is likely to represent sites where changes do not alter the control mechanism. Considering the degree of homology among the two variants it seems that the gene duplication which dispersed the hsp70 genes at the 87A7 and 87Cl loci occurred earlier in evolution than the duplication that produced the tandem array at locus 87Cl. The Z,, element is, however, not a general feature of heat shock genes. Apart from the hsp70 and ~$3 heat shock genes it has not been found either in front of the hsp27, 26, 23 and 22 genes by cross- hybridization (Voellmy, personal communication) nor in front of the hsp83 gene by sequence analysis (R. W. Hackett & J. T. Lis, personal communication).
(e) Possible control sequences within Z,, am! .th beginning of 2,
We have positioned the 5’ end of the hsp70 mRNA at 1 f2 (Tiitik & Karch, 1980), while Ingolia et al. (1980) placed it three base-pairs upstream in fairly good agreement. It is, however, difficult to reconcile this latter determination with our results obtained by reverse transcription in the presence of chain terminators
EXTENSIVE HOMOLOGIES PRECEDE hsp70 GENES 2‘29
(Tijrok $ Karch, 1980). At the 5’ end of Z, the long untranslated region of253 bases is lOOq/, homologous in both 13233 repeats and in the first G3 hsp70 gene (Ingolia et ul., 1980). However, a deletion of 21 bases occurs in the untranslated sequence of the second G3 gene starting two base-pairs downstream from the cap site. It would be interesting to know if this gene is active. It is plausible that particular sequences in the very first region of the hsp70 genes could function for the specific translational recognition of heat shock messengers, since the mRNAs synthesized at the normal temperature are still present in the cytoplasm during heat shock though excluded from the polysomes (McKenzie et al., 1975; Mirault et al., 1978).
The untranslated sequences are also highly conserved between the two variants showing only 12”/b divergence as mentioned above. We find the characteristic
“Hogness box” (Goldberg, 1979; for a review, see Benoist et al., 1980) 26 base-pairs upstream from the 5’ end of the hsp70 mRNA in the 13233 genes exactly as in 56H8 (TBr6k & Karch, 1980) and in G3 (Ingolia et al., 1980). From the T-A-T-A-A-A-T-A motif to the right until position 25 in Z,, there are only two base substitutions between the two variants, so that all the homologies with other genes discussed for 56H8 and G3 also apply to 13233 (Tijriik & Karch, 1980; lngolia et al., 1980). In the region 70 to 80 nucleotides upstream from the cap site of the hsp70 gene we find no homology with the consensus sequence described by Benoist et al. (1980) present in other genes. Nevertheless, as reported by Ingolia et al. (1980), this region shares partial homology with the corresponding one in the Bombyx wwri fibroin gene (Tsujimoto & Suzuki, 1979). A similar sequence is, however, not found in front of the DrosophiZa histone genes (Goldberg, 1979). Preliminary sequence comparison of hsp70 and hsp83 (R. W. Hackett & J. T. Lis, personal communication) shows the conservation of a hexanucleotide, G-A-A-A-A-G, very close upstream from the T-A-T-A-A-A-T-A motif (position -44, Fig. 3).
(f) The region, duplicated in 132E3 extends further upstream from Z,,
The tandem repeats of the hsp70 genes or the $l sequences present at 87Cl could have been generated by unequal crossing over. The sequence homology between both 13233 repeats upstream from Z,, extends to position -590, 20 bases downstream from X. If no further rearrangements occurred following the
hypothetical crossing over, the break-point of the DNA exchange could map in a segment extending from the right border of the X element to the beginning of the homology between both repeats roughly around position - 590 (Fig. 3). At position - 570 there is a direct repetition of eight bases in the first 13233 repeat. In contrast, there is only one octanucleotide present in the second copy. It should be noted that this motif occurs very near to the hypothetical break-point of the DNA recombination event as seen by sequence homology. The presence of a completely homologous Z,, element with a characteristic Hogness box in front of each of the two 13233 hsp70 genes suggests that they are separately transcribed if they are both expressed in vivo. It should be noted that no transcript of the 13233 spacer has been detected so far (M.-E. Mirault, unpublished observation).
This work was supported by a grant from the Swiss National Science Foundation (no. 3512.79 to A.T.). We thank 0. Jenni and Y Epprecht for drawings and B. Rrun for
230 F. KARCH, I. TiiRi)K AND A. TISSIkRES
typing the manusciipt. We also thank J. !I!. Lis, M.-E. Mirault, P. Schedl and R. Voellmy for their comments and helpful discussions on the manuscript. We would particularly like tc~
acknowledge R. Bach, D. Galas and F. Veuthey for the development of computer programs.
REFERENCES
Artavanis-Tsakonas, S., Schedl, P., Mirault, M.-E., Moran, L. & Lis, J. T. (1979). Cell, 17,9- Ashburner, M. & Bonner, J. J. (1979). CeZl, 17, 241-254. 18.
Benoist, C., O’Hare, K., Breathnach, R. & Chambon, P. (1980). Nucl. Acids Res. 8, 127-142.
Caggese, C., Caizzi, R., Morea, M., Scalenghe, F. & Ritossa, F. (1979). Proc. Nat. Acad. Sci., U.S.A. 76, 2385-2389.
Craig, E. A., McCarthy, B. J. & Wadsworth, S. C. (1979). Cell, 16, 575-588.
Efstratiadis, A., Kafatos, F. C. & Maniatis, T. (1977). CeZE, 10, 571-585.
Efstratiadis, A., Pomkony, J. W., Maniatis, T., Lawn, R. M., O’Connell, C., Spritz, R. A,, De Rid, J. K., Forget, B. G., Weissmann, S. M., Slightom, J. L., Blechl, A. E., Smithies, O., Baralle, F. E., Shoulders, C. C. & Proudfoot, N. ,J. (1980). Cell, 21, 653-668.
Goldberg, M. (1979). Ph.D. thesis, Stanford University, Stanford, Calif.
Goldschmidt-Clermont, M. (1980). Nucl. Acids Res. 8, 235-252.
Holmgren, R., Livak, K. F., Morimoto, R., Freund, R. & Meselson, M. (1979). Cell, 18, 1359- 1370.
Tngolia, T. D., Craig, E. A. & McCarthy, B. J. (1980). Cell, 21, 669-679.
Ish-Horowitz, D. $. Pinchin, S. M: (1980). J. Mol. Biol. 142, 231-245.
Ish-Horowitz, D., Pinchin, S. M., Schedl, P., Artavanis-Tsakonas, 6. $ Mirault, M.-E.
(1979). Cell, 18, 1351-1358.
Kedes, L. H. (1979). Annu. Rev. Rio&em. 48, 837-870.
Lis, J. T., Prestidge, L. & Hogness, D. S. (1978). CeZZ, 14, 901-919.
Lis, J. T., Neckameyer, W., Mirault, M.-E., Artavanis-Tsakonaa, S., Lall, P., Martin, G. &
Schedl, P. (1981). Develop. BioZ., in the press.
Livak, K. F., Freund, R., Schweber, M., Wensink, P. C. & Meselson, M. (1978). Proc. Nat.
Acad. hi., U.S.A. 75, 5613-5617.
Maxam, A. & Gilbert, W. (1977). Proc. Nut. Acud. Sci., U.S.A. 74, 56&564.
Maxam, A. $ Gilbert, W. (1980). In Methods in Enzymology (Grossmann, L. & Moldave, K., edsj, vol. 65, pp. 499-560.
McKenzie, S. L., Henikoff, S. & Meselson, M. (1975). Proc. AVat. Acad. Sci., U.S.A. 72, 1117- 1121.
Mirault, M.-E., Goldschmidt-Clermont, M., Moran, L., Arrigo, A. P. & TissiBres, A. (1978).
Cold Spring Harbor Symp. &ant. Biol. 42, 819-827.
Mirault, M.-E., Goldschmidt-Clermont, M., Artavanis-Tsakonas, S. & Schedl, P. (1979).
Proc. Nat. Acud. Sci., U.S.A. 76, 5254-5258.
Moran, L., Mirault, M.-E., TissiBres, A., Lis, J., Schedl, P., Artavanis-Tsakonas, S. &
Gehring, W. J. (1979). Cell, 17, l-8.
Proudfoot, N. J. I%. Brownlee, G. G. (1976). Nature (London), !%3, 211-214.
Ritossa, F. M. (1962). Eqerientia, 18, 571-573.
Russel, G. J., Walker, P. M. B., Elton, R. A. & Subak-Sharpe, J. H. (1976). J. Mol. Biol. 108, l-23.
Sanger, F. & Coulson, A. R. (1978). FEBS Letters, 87, 107-110.
Schaffner, W., Kunz, G., Daetwyler, H., Telford, J., Smith, H. 0. AZ Birnstiel, M. L. (1978).
Cell, 14, 655-671.
Schedl, P., Artavanis-Tsakonas, S., Steward, R., Gehring, W. J., Mirault, M.-E., Goldschmidt-Clermont, M., Moran, L. & TissiBres, A. (1978). Cell, 14,921-929.
Tissiitres, A., Mitchell, H. K. & Tracy, U. M. (1974). J. Mol. BioE. 64, 389-398.
Ttirijk, I. & Karch, F. (1980). Nucl. Acids Res. 8, 3105-3123.
Tsujimoto, Y. I% Suzuki, Y. (1979). Cell, 18, 591-600.
Wu, C. (1980). Nature (London), 266, 854-860.
