• Aucun résultat trouvé

Chloroplast DNA variation and parentage analysis in 55 apples

N/A
N/A
Protected

Academic year: 2022

Partager "Chloroplast DNA variation and parentage analysis in 55 apples"

Copied!
5
0
0

Texte intégral

(1)

Article

Reference

Chloroplast DNA variation and parentage analysis in 55 apples

SAVOLAINEN, Vincent, et al.

Abstract

The chloroplastic atpB-rbcL spacer and the first 53 codons of the rbcL coding sequence was sequenced for 40 apple cultivars and 15 wild species. This chloroplast DNA region is 904 base pairs long, and only five mutations sites were found among the tested samples. Although the cpDNA variation was low, some parentages are proposed based on the maternal inheritance of plastid DNA: the male and female parents are specified, or else suggested, for Worcester, Discovery, Starking, Starkrimson, Kidd's Orange Red, Priscilla, and Gloster, as well as for the putative wild origin for Malus x domestica.

SAVOLAINEN, Vincent, et al . Chloroplast DNA variation and parentage analysis in 55 apples.

Theoretical and Applied Genetics , 1995, vol. 90, no. 7-8, p. 1138-1141

DOI : 10.1007/BF00222934

Available at:

http://archive-ouverte.unige.ch/unige:123251

Disclaimer: layout of this document may differ from the published version.

1 / 1

(2)

V. Savolainen 9 R. Corbaz 9 C. Moncousin 9 R. Spichiger J.-F. Manen

Chloroplast DNA variation and parentage analysis in 55 apples

Received: 4 October 1994 ! Accepted: 15 December 1994

A b s t r a c t The chloroplastic a t p B - r b c L spacer and the first 53 codons of the r b c L coding sequence was sequenced for 40 apple cultivars and 15 wild species. This chloroplast D N A region is 904 base pairs long, and only five muta- tions sites were found among the tested samples. Although the cpDNA variation was low, some parentages are pro- posed based on the maternal inheritance of plastid DNA:

the male and female parents are specified, or else sug- gested, for Worcester, Discovery, Starking, Starkrimson, Kidd's Orange Red, Priscilla, and Gloster, as well as for the putative wild origin for M a l u s x d o m e s t i c a .

K e y w o r d s M a l u s 9 Non-coding D N A sequence 9 D N A polymorphism - r b c L 9 Parentages analysis

Introduction

There are several hundred apple cultivars. Their origins are often unknown, especially those of the old varieties which are of great value for their genetic and flavour diversity.

Thus, biochemical and molecular investigations are cur- rently proceeding to obtain genetic markers of cultivars and on accurate genealogy for further plant breeding work.

For example, isozyme electrophoretic analysis has proved useful in apple cultivar identification (Weeden and L a m b 1985; Bournival and Korban 1987). Since the M13 phage repeat probe was able to detect D N A minisatellite-like sequences in plants (Rogstad and al. 1988), D N A

Communicated by G. Wenzel

V. Savolainen ([]) 9 R. Spichiger 9 J.-F. Manen Conservatoire et Jardin Botaniques de Gen~ve, CH-1292 Chambdsy, Geneva, Switzerland R. Corbaz

Station F6d6rale de Recherches Agronomiques de Changins, CH- 1260 Nyon, S witzerland

C. Moncousin

Centre Horticole de Lullier, CH-1254 Jussy, Geneva, Switzerland

'fingerprints' have also been used for parentage analysis in some fruits, including apples (Nybom 1990; N y b o m and Schaal 1990 a, b; N y b o m et al. 1990). Additionally, RFLP (restriction fragment length polymorphism) has been ap- plied to parentage analysis in apples (Alston and Batlle 1992; Ishikawa et al 1992; Simon and Weeden 1992; Ish- ikawa 1993). The recent RAPD method (randomly ampli- fied polymorphic DNA) has also been used for apples (Ha- rada et al 1993; Koller et al 1993). Here, we report the se- quencing of the chloroplast a t p B - r b c L spacer and the first 53 codons of the r b c L coding sequence (representing 904 base pairs), in 40 apple cultivars and 15 wild species. The aim of this analysis was to investigate: (1) the intra-spe- cific D N A polymorphism of this c p D N A region in a crop plant, (2) the putative wild origin of the domestic apple, and (3) the parentages of some of the tested cultivars.

Materials and methods

Leaf samples of 55 apple cultivars and wild species were obtained from collections in Switzerland (Centre Horticole de Lullier, Arbo- retum d'Aubonne, Eidgen6ssische Forschungsanstalt fiJr Obst- Wein- und Gartenbau-W~idenswil, Conservatoire et Jardin bota- niques de Gen6ve) and in Germany (Genbank Obst Dresden).

Total DNA was extracted by the method of Edwards et al. ( 1991), or by a modification of the method of Webb and Knapp (1990). A +900-bp cpDNA region (the atpB-rbcL spacer and the first 53 co- dons of rbcL) was amplified by PCR using the oligonucleotides 5'GAAGTAGTAGGATTGATTCTC 3' and 5'TACAGTTGTCCA~

TGTACCAG 3' as primers (Savolainen et al. 1994). The PCR prod- ucts were run in a 1% agarose gel stained with ethidium bromid, cut off from the gel, purified with silica particles (Prep-A-Gene, Bio- Rad), and sequenced directly with the amplification primers and the additional primers 5 'CCCTACAACTCATGAATTAAG 3', 5'GTCTATCATTATAGACAATCCC 3', 5'CATCATTATTGTA- TACTCTTTC 3', and 5'GTAAATCCTAGATGTAAAA 3' (Savolai- nen et al. 1994). The obvious cpDNA phylogenetic relationships (on- ly five mutation sites found) were represented using the graphic fa- cilities of the PAUP software (Swofford 1993). The Rosa damasce- na sequence (Savolainen et al. 1994) was used as an outgroup. DNA sequences of Idared, Discovery, and R. damascena were registrated in EMBL/GenBank Nucleotide Sequence databases under accession numbers X69749, X69750, and X69753, respectively.

(3)

T T T T T T G C G A A A A T T A C T G A A A T C A A A A A T A A A T G T T C G A T A G C A A A A C A 50 A G T T A A G T T G A T C G G T T A A T T C A A T A A G A A A T A G G C C T T A G C G C T C G A T T i00 T C G T T G G T A C C A T C C A A C T G A A T C C A A T T C A A T T G T T T A C T T A T T C A A T T 150 T C A G T G A A T T G A A A A A T T C A A C G A A A A C C C A T T T T C A A A A C A T C A A G T G T 200 T A T G A A T A A A A A T T T T G A T A A A G T C T T T T A T T T G C C T A T C A T T A T A G A C A 250 A T A C C T T C C A T A T T A T C T A T G G P I T T C G A A T C C G A A C C C T A T A A A T T A C G 300 A T T T C T T T T T T C T A T C T C A T T G G T C C T T A T T T A C G A T A T C A G C A T A T C G A 350 T T T A C G C T T T A G C C T A T T A T T T T T A G C C T A A G T A T T T T T C A T G T T T A T G G 400 A C G A A T T C T G C A T A T T T T T A T A T T T A G G A T T T A C A T A T A C A A C A T A T A T C 450 A C T G T C A A G A G C G A A T T T C T T A T T A T T T A G A T A T T T C G A T T C A A A A A A G T 500 A A G A T A T T A G A A A C T T G A A A A A C A A A G A T T G G G T T G C G C C A T A C A T A T G A 550 A A G A G T A T A C A A T A A T G A T G T A T T T G G C G A A T C A A A T A C C A C G G T C T A A T 600 A A C G A A C C G T T C T G A T T A G T T G A T A A T A T T A G T T G A T A G T T T T G T G A A A G 650 A T T C T G T G A A A G G T T T C A T T A A C T T C A T A A T T T A T G T C G A G T A G A C C T T G 7 0 0 T T C T T G T G A G A A T T A T T A A T T G A T T A G T T G T A G G G A G G G A C T T A T G T C A 7 4 9 C C A C A A A C A G A G A C T A A A G C A A G T G T T G G A T T C A A A G C T 7 8 8 G G T G T T A A A G A T T A T A A A T T G A C T T A T T A T A C T C C T G A C 827 T A T G A A A C C A A A G A T A C T G A T A T T T T G G C A G C A T T T C G A 866 G T A A C T C C T C A A C C T G G A G T T C C A C C T G A G G A A G C A G G 9 0 4

Fig. 1 DNA sequence of the atpB-rbcL spacer and the first 53 co- dons of rbcL in Malus x domestica cv Idared. The rbcL coding se- quence begin at position 744. This sequence is identical in all ap- ples, except for five mutation sites which are in bold characters: at position 17, C is replaced by T in Kidd's Orange Red, Starking, Pris- cilla, Starkrimson, Gloster, Yellow Transparent, Worcester, Discov- ery, and stock emla9b (=Paradis Jaune de Metz); at position 30, T is replaced by G in M.trilobata; at position 31, A is replaced by T in M.ioensis; at position 326, C is replaced by T in M.pumila, M.bac- cata, M.halliana, M.floribunda, M.sieboldii, M.sargentii, M.torin- goides; at position 463, G is replaced by T in M.kansuensis

Results

From the 904-bp-long sequenced c p D N A region, only five mutation sites were found among the 5 5 apple samples (Fig. 1). R. damascena was used as an outgroup in the phy- logenetic tree (Fig. 2). Its D N A sequence was aligned with the Malus sequences, yielding a 936-bp-long matrix with 62 variable sites (data not shown), which allows us to de- termine the probable plesiomorphic and apomorphic mu- tations. The first mutation is a transition at position 17; all the cultivars have a cytosine at this position except for Worcester, Gloster, Discovery, Kidd's Orange Red, Pris- cilla, stock Emla9b (=Paradis Jaune de Metz), Yellow Transparent 1 and 2 and the Red Delicious family (includ- ing Starking, Starkrimson), which have a thymine. The three other mutations are autapomorphic transversions, Malus trilobata having a guanine at position 30 instead o f thymine, Malus ioensis having a thymine at position 31 in- stead o f adenine, and Malus kansuensis having a thymine at position 463 instead o f guanine. Finally, the last muta- tion is a synapomorphic transition for seven wild apples, M.pumila, M.baccata, M.floribunda, M.sieboldii, M.sar- gentii, and M.toringoides, which each have a thymine at position 326 instead o f cytosine.

Discussion

c p D N A polymorphism o f the atpB-rbcL spacer

According to the Harris and Ingram review (1991), intra- specific chloroplast D N A variation is relatively c o m m o n

1139

m

I17

326

~46130

|31

~ D i s c o v e r y I

~ K i d d ' s Orange red I StorKing I P r i s c i l l o l Storkrimson I G1oster 1

Y e l l o w Transparent I , Y e l l o w Transparent 2

Worcester 3

~ s t o c k emlo9b:Porodis jaune I Jonathan Watson I

F l o r i n o I

Pomme R a i s i n Rouge I Primerouge z Summerred 1

~ ] o n n e e l Pomme R a i s i n I

B e l l e de Boskoop Rouge z Gravenstein I

Idared z

Golden D e l i c i o u s z

~ A r l e t I

R e i n e t t e du Canada z Pomme Cloche I Cox Orange z Gala z

Cox Orange R e i n e t t e I E l s t o r z

Reine des R e i n e t t e s 2 - - Y e l l o w B e l l f l o w e r z - - T r f i b o u x 4

- - T r o n s p a r e n t e Blanche s - - T r a n s p a r e n t e de Croncels s

] u l y r e d 3 - - B e a u t y o f Both I

Imperotore 3 Mclntosh i - - M o l u s s v l v e s t r i s 2

Malus f l o r e n t i n o z

~ M a l u s d a s y p h y l I a 2 Molus p l a t y c o r p a z Malus fusca 2 s t o c k cost1=Golden I stock cost699:Golden z

~ s t o c k G3595 z

Molus pumila 2

~ M a l u s baccota 2 - - M o l u s h o l l i o n o 2

" Malus f l o r i b u n d o z - - M o l u s s i e b o l d i i 2 - - N o l u s s o r ~ e n t i i 2 - - M o l u s t o r l n g o i d e s z

Motus konsuensis z Molus t r i l o b o t o 2 Molus i o e n s i s z .... Rosa 6

Fig. 2 Proposed phylogenetic relationships among the tested apples with an indication of the mutations and their position (see Fig. 1).

Origin is indicated as: 1, Centre Horticole de Lullier-CH; 2, Gen- bank Obst Dresden-D; 3, Eidgen6ssische Forschungsanstalt ffir Obst- Wein- und Garten-bau of W~denswil (Swiss Federal Station for Fruit-Growing Viticulture and Horticulture)-CH; 4, Arboretum d'Aubonne-CH; 5, Personal collection of R.Corbaz-CH; 6, Conser- vatoire et Jardin botaniques de Gen~ve-CH

and could have s o m e effect on phylogenetic reconstruc- tion. Thus, the first aim of the present study was to test the c p D N A variation o f the atpB-rbcL spacer at the intra-spe- cific level, because w e have used this D N A region in phy- logenetic analysis at higher taxonomic levels (Spichiger et al. 1993; Manen et al. 1994; Savolainen et al. 1994). In fact, w e found a very l o w c p D N A diversity, as previously reported in other crop plants (e.g. Clegg et al. 1984; Ishii et al. 1986; Shoemaker et al. 1986), only one single muta- tion site being present in the D N A region sequenced among 40 cultivars (Fig. 1). This mutation (a transition at posi- tion 17, see Results) was found in ten samples and checked three times by repeating the procedures from extraction to sequencing. This demonstrates the high fidelity o f the Taq polymerase and the PCR technique (Kwiatowski et al.

1991).

(4)

Putative wild origin of the domesticated apple Malus x domestica

The putative wild origin for Malus • domestica is hybrid and it has been suggested to be derived from M.syIvestris, M.dasyphyIla, M.pumila, and some Asiatic species (Terp6 1968). We sequenced the atpB-rbcL spacer in 15 wild spe- cies, where four other mutation sites were found in addi- tion to the mutation mentioned below (Figs. 1,2). This still represents a low level of DNA variation, compared for ex- ample to GaIium spp. (Manen et al. 1994), Ilex spp., or Anemone spp. (unpublished results), from which we se- quenced the same DNA region. Despite this limited phy- logenetic information, we can define some parentages.

Taking into account maternal inheritance of cpDNA, the female parent and the resulting hybrid lineage must share the same DNA sequence. Thus, ten wild species are ex- cluded from being the female parent of Malus x domes- tica. M.kansuensis, M.trilobata, and M.ioensis, which originated respectively from China, the Middle East, and North America ( Schneider 1904; Bossard and Cuisance 1984), are excluded because of their characteristic autap- omorphies (Figs. 1, 2). M.pumila, M.baccata, M.halliana, M.floribunda, M.sieboldii, M.sargenti, and M.toringoides, which originated from Eastern Asia (Hughes 1920; Bos- sard and Cuisance 1984), are also excluded because of the shared mutation at position 326 (Figs. 1, 2). Among the species analysed, only three European species, M.sylves- tris, M.florentina and M.dasyphylla, (Terp6 1968), or two North American species, M.platycarpa and M.fusca (Schneider 1904; Sargent 1913), could have transmitted their plastid genome and thus be the potential female par- ent ofMalus x domestica. Obviously, our results do not al- low a precise determination of the hybrid nature of the cul- tivated apple which is probably of multiple origin with in- trogression. However, they indicate that several European and American wild species might be candidates for the fe- male parent. Moreover, if the Asiatic wild species tested are involved, then these would be the male parent.

Parentages of some of the tested cultivars

Additionally, if we look at the proposed origins for the cul- tivars, Gala is presented as the hybrid of Kidd's Orange x Golden Delicious (Votteler 1993). Gala having a cyto- sine at position 17 (Fig. 1), the female parent is neces- sarily Golden Delicious and the male parent is Kidd's Orange.

Because the mutation at position 17 could only be trans- mitted maternally, some other parentages can be specified as presented in Fig. 3. For instance, Worcester has Beauty of Bath as male parent, and is the female parent of Discov- ery, but the male parent of Primerouge. The Red Delicious family (including Starking, Starkrimson) are the female parents of Kidd's Orange Red, Priscilla, and Gloster. Thus, our results are in disagreement with those of Aeppli et al.

(1989) who concluded by following the 'ladies first' rule, that Red Delicious (=Richard Delicious) is the male par-

I E'LOOT ANS"AR7 7 *l

I \

\ r 1

Fig. 3 Proposed parentages in the the Red Delicious family and other related cultivars (with place and time of origin) based on the maternal inheritance of chloroplast DNA. The cultivars whose DNA sequences have the mutation at position 17 (Fig. 1), i.e. the apomor- phic thymine instead of the plesiomorphic cytosine, are framed in bold. Although Duke of Devonshine has not been sequenced, it is in- cluded in this figure according to the existing bibliography

ent. In fact, Kidd's Orange Red, Priscilla, and Gloster have Cox Orange, McIntosh, and Pomme Cloche as male par- ent, respectively. The Red Delicious family has been claimed to arise from a random seedling of Yellow Bell- flower (Aeppli et al. 1989). Since this latter cultivar does not have the mutation found in Red Delicious it cannot be its direct ancestor. However, three explanations are pos- sible: (1) the Red Delicious family is a mutated lineage of Yellow Bellflower, (2) it is a hybrid between Yellow Bell- flower as mate parent and an unknown lineage bearing the mutation as female parent, or (3) it is the direct descendant of an unknown lineage bearing the mutation. In order to resolve this situation, we have searched for this mutation in other old varieties. We found it in Yellow Transparent, which came from Russia and the Baltic states in the mid t 9th century. Thus, based on our cpDNA sequencing, Yel- low Transparent could be the female parent of the Red De- licious family and of Worcester. Other derived lineages can also now be followed by the presence of the mutation at position 17 (Fig. 1). Unfortunately, there is no available restriction enzyme which can be used as genetic marker for this position; therefore short sequencing runs remains the only alternative strategy.

Acknowledgements We thank the Genbank Obst of Dresden (G), the Arboretum of Aubonne (CH), and the EidgenOssische Forschung- sanstalt ftir Obst-, Wein- und Garten-bau of Wfidenswil (CH) for pro- viding plant samples, and Sonia de Marchi for technical assistance.

This work was partially funded by the Fonds National Suisse de la Recherche Scientifique (grant N. 31-28757.90).

References

Alston FH, Batlle I (1992) Genetic markers in apple breeding. Phy- toparasitica 20:89S-92S

(5)

Aeppli A, Gremminger U, Kellerhals M, Rapillard C, R6thlisberger K, Rusterholz P (1989) Vari6tds de fruits. Centrale des moyens d'enseignement agricole, Zollikofen, Switzerland

Bossard R, Cuisance P (1984) Arbres et arbustes d'ornement des r6gions temp~r6es et m6diterrandennes. Lavoisier, Paris Bournival BL, Korban SS (1987) Electrophoretic analysis of genet-

ic variability in the Apple. Sci Hort 31:233-243

Clegg MT, Brown AHD, Whitfeld PR (1984) Chloroplast DNA vari- ation in wild and cultivated barley: implication for genetic con- servation. Genet Res 43:339-343

Edwards K, Johnstone C, Thompson C (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR anal- ysis. Nucleic Acids Res 19:1349

Harada T, Matsukawa K, Sato K, Ishikawa R, Niizeki M, Saito K (1993) DNA-RAPDs detect genetic variation and paternity in Malus. Euphytica 65:87-91

Harris SA, Ingrain R (1991) Chloroplast DNA and biosystematics:

the effects of intraspecific diversity and plastid transmission. Tax- on 40:393-412

Hughes (1920) Decades Kewensis. Kew Bull 1920:205-207 Ishii T, Terachi T, Tsunekawi K (1986) Restriction endonuclease

analysis of chloroplast DNA from cultivated rice species Oryza sativa and O.glaberrima. Jpn J Genet 61:537-541

Ishikawa S (1993) History of cultivated apple with mitochondrial DNA. Kagaku to S eibutsu 31:609-611

Ishikawa S, Kato S, Imakawa S, Mikami T, Shimamoto Y (1992) Or- ganelle DNA polymorphism in apple cultivars and rootstocks.

Theor Appl Genet 83:963-967

Koller B, Lebmann A, McDermott JM, Gessler C (1993) Identifica- tion of apple cultivars using RAPD markers. Theor Appl Genet 85:901-904

Kwiatowski J, Skarecky D, Hernandez S, Pham D, Quijas F, Ayala FJ (1991) High fidelity of the polymerase chain reaction. Mol Biol Evol 8:884-887

Marten JF, Natali A, Ehrendorfer F (1994) Phylogeny of Rubiaceae- Rubieae inferred from the sequence of a cpDNA intergene re- gion. P1 Syst Evol 190:195-211

Nybom H (1990) DNA fingerprints in sports of 'the Red Delicious family' apples. HortScience 25:1641-1642

1141 Nybom H, Schaal BA (1990 a) DNA "fingerprints" applied to pater- nity analysis in apples (Malus x domestica). Theor Appl Genet 79:763-768

Nybom H, Schaal BA (1990 b) DNA "fingerprints" reveal genotyp- ic distributions in natural populations of blackberries and rasber- ries (Rubus, Rosaceae). Am J Bot 77:883-888

Nybom H, Rogstad SH, Schaat BA (1990) Genetic variation detect- ed by use of the M13 "DNA fingerprint" probe in Malus, Pru- nus, and Rubus (Rosaceae). Theor Appl Genet 79:153-156 Rogstad SH, Patton JC, Schaal BA (1988) M13 repeat probe detects

DNA minisatellite-like sequences in gymnosperms and angio- sperms. Proc Natl Acad Sci USA 85:9176-9178

Sargent CS (1913) Trees and shrubs. II. Houghton Mifflin, Boston New York

Savolainen V, Manen JF, Douzery E, Spichiger R (1994) Molecular phylogeny of families related to Celastrales based on rbcL 5' flanking sequences. Mol Phyl Evol 3:27-37

Schneider CK (1904) Handbuch der Laubholzkunde I. Gustav Fish- er, Jena

Shoemaker RC, Hatfield PM, Palmer RG, Atherty AG (1986) Chlo- roplast DNA variation in the genus Glycine subgenus Soja. J He- redity 77:26-30

Simon CJ, Weeden NF (1992) Molecular analysis of MaIus riboso- mal DNA. J Am Soc Hort Sci 117:164-168

Spichiger R, S avolainen V, Manen JF (1993) Systematic affinities of Aquifoliaceae and Icacinaceae from molecular data analysis.

Candollea 48:459-464

Swofford D (1993) PAUP: Phylogenetic analysis using parsimony.

Version 3.1. Smithsonian Institution

Terp6 A (1968) Malus. In: Tutin TG, Heywood VH, Burges NA, Moore DM, Valentine DH, Walters SM, Webb DA (eds) Flora Europea, vol 2. Cambridge University Press, pp 66-67 Votteler W (1993) Verzeichnis der Apfel- und Birnensorten. Obst-

und Gartenbauverlag, Mtinchen

Webb DM, Knapp SJ (1990) DNA extraction from a previously re- calcitrant plant genus. Plant Mol Biol 8:180-185

Weeden NF, Lamb RC (1985) Identification of apple cultivars by iso- zyme phenotypes. J Amer Soc Hort Sci 110:509-515

Références

Documents relatifs

Although DNA tests can be used by mothers and children who are trying to find a biological father or have him acknowledge his paternity, they are also just as likely

Although moderatelyresolved, the phy logenies resulting from the separate analyses of nuclear and chlo- roplast data are congruent, and the incongruence length di€erence test (Farris

We demonstrate here, via the study of the three new derivatives, that the azacryptands are indeed valuable molecular tools to trigger DNA damage in treated cancer cells and that

Based on sequences available in GenBank and sequences produced for this study, we evaluated the resolution power of the whole chloroplast trnL (UAA) intron (254–767 bp) and of a

Tetraploid ‘Moncada’ mandarin was obtained directly from shoot tip grafting combined with colchicine treatment (Aleza et al. reticu- lata) as male parent (from here on referred as

11 11-Population genomics to detect local adaptation: application to Bti resistance monitoring in mosquitoes at a regional scale.. Laurence Després, Guillaume

Our aim was to identify the respective role of each METase family in the hypomethylation of genomic DNA which has been measured in “mantled” material (Jaligot et al, 2000). The

Even though the exploration of epigenetic phenomena has been intensively developed for the study of cancer and many human disease syndromes, only a few groups are studying