Novel presenilin mutations within Moroccan patients with Early-Onset Alzheimer's Disease

Accepted Manuscript

Novel Presenilins mutations within Moroccan patients with Early Onset Alz- heimer’s Disease

Nadia El Kadmiri, Nabil Zaid, Younes Zaid, Artavazd Tadevosyan, Ahmed Hachem, Marie-Pierre Dubé, Khalil Hamzi, Bouchra El Moutawakil, Ilham Slassi, Sellama Nadifi

PII: S0306-4522(14)00275-9

DOI: http://dx.doi.org/10.1016/j.neuroscience.2014.03.052

Reference: NSC 15318

To appear in: Neuroscience Received Date: 25 January 2014 Revised Date: 6 March 2014 Accepted Date: 26 March 2014

Please cite this article as: N. El Kadmiri, N. Zaid, Y. Zaid, A. Tadevosyan, A. Hachem, M-P. Dubé, K. Hamzi, B.

El Moutawakil, I. Slassi, S. Nadifi, Novel Presenilins mutations within Moroccan patients with Early Onset Alzheimer’s Disease, Neuroscience (2014), doi: http://dx.doi.org/10.1016/j.neuroscience.2014.03.052

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Novel Presenilins mutations within Moroccan patients with Early Onset Alzheimer’s Disease

Nadia El Kadmiri¹, Nabil Zaid³, Younes Zaid³,Artavazd Tadevosyan³, Ahmed Hachem³, Marie-Pierre Dubé³, Khalil Hamzi¹, Bouchra El Moutawakil^1,2, Ilham Slassi^1,2, Sellama Nadifi¹

Authors affiliations:

1 Laboratory of Medical Genetics and Molecular Pathology, Faculty of Medicine and Pharmacy, University Hassan II, Casablanca, Morocco.

2 Department of Neurology CHU IBN ROCHD, Casablanca, Morocco.

3 Montreal Heart Institute and Université de Montréal, Montreal, Canada.

First author surname and short title: El Kadmiri, PS1, PS2 mutations in Alzheimer's Disease

Keywords: Moroccan patients; Alzheimer’s Disease; frameshift mutations ; PS1 PS2 genes Word count of Manuscript: 4117

Word count of abstract: 296 Total number of figures: 4 Total number of tables: 2

References: This article cites 24 articles.

Correspondence to Nadia El Kadmiri, Laboratory of Medical Genetics and Molecular Pathology, Faculty of Medicine and Pharmacy, University Hassan II, 19 Rue Tarik Ibnou Ziad, B.P. 9154Casablanca 20000, Morocco; Tel: + 212 6 41 61 98 35;

e-mail: elkadmiri1979@gmail.com.

Abstract

Alzheimer's disease (AD) is a progressive brain disorder that causes gradual and irreversible loss of higher brain functions and is the most common cause of dementia in the elderly, , as assessed by autopsy and clinical series. Furthermore, it has an annual incidence of approximately 3% in the 65–74 age group. This incidence rate doubles with every increment of 5 years above the age of 65. In Morocco, AD affects almost 30,000 individuals and this number will possibly increase to 75,000 by 2020 (projections of the World Health Organization (WHO)). Genetically, Alzheimer disease is caused by a mutation in one of at least 3 genes: presenilin 1 (PS1), presenilin 2 (PS2) and amyloid precursor protein (APP).

Most cases are late onset and apparently sporadic, most likely as a result of a combination of environmental and non-dominant genetic factors. In Morocco, the genes predisposing individuals to Alzheimer’s disease (AD) and predicting disease incidence remain elusive. The purpose of the present study was to evaluate the genetic contribution of mutations in the PS1 and PS2 genes to familial early-onset AD cases and sporadic late-onset AD cases. Seventeen sporadic late-onset AD cases and eight familial early-onset AD cases were seen at the memory clinic of the University of Casablanca Neurology Department. These patients underwent standard somatic neurological examination, cognitive function assessment, brain imaging and laboratory tests. Direct sequencing of each exon in PS1 and PS2 genes was performed on genomic DNA of AD patients. Further, we identified 1 novel frameshift mutation in the PS1 gene and 2 novel frameshift mutations in the PS2 gene. Our mutational analysis reports a correlation between clinical symptoms and genetic factors in our cases of Early Onset Alzheimer’s Disease (EOAD). These putative mutations cosegregate with affected family members suggesting a direct mutagenic effect.

1. Introduction

Alzheimer’s disease (AD) is the most common form of neurodegenerative dementia of the human central nervous system and remains the leading unmet medical need in neurology. AD is clinically characterized by a progressive loss of cognitive function and by the onset of slowly progressive memory impairment. Pathological changes underlying AD process in the brain is characterised by two types of lesion: beta-amyloid (Aβ) peptide deposits (known as senile plaques) and accumulation of neurofibrillary tangles (Bertram et al., 2010). Three genes have been identified to date in which mutations result in early-onset familial AD, inherited in an autosomal dominant fashion. These genes are the amyloid precursor protein (APP) on chromosome 21 (more than 30 pathogenic mutations have been described), presenilin-1 gene (PS1) on chromosome 14 (associated to more than 170 mutations), and presenilin-2 gene (PS2) on chromosome 1 (only 18 potentially pathogenic mutations have subsequently been reported, making this the least common genetic cause of Alzheimer’s disease) (available at:

http://molgen-www.uia.ac.be/ADmutations). Apolipoprotein E alters the risk for, and the age of onset of the common late-onset type of AD (Lendon et al., 1997). Cell-based studies and mouse models have shown that mutations in genes encoding APP, PS1 and PS2 causes an increased production of the neurotoxin Aβ42 (Theuns and Van Broeckhoven, 2000), indicating that unbalanced APP processing may be the primary event leading to the neurodegenerative brain pathology in AD patients carrying these mutations.

In Morocco, AD has emerged as a serious public concern with the number of people suffering from AD expected to increase as the elderly population continues to grow. Genes predisposing individuals to AD and predicting disease incidence remain elusive and prevent health care professionals from identifying AD in its early stages, with the goal of slowing down the progression. Accordingly, the aim of the present study was to evaluate the genetic

contribution of mutations in the presenilin-1 (PS1) and presenilin-2 (PS2) genes to familial early-onset AD cases and sporadic late-onset AD cases.

2. Experimental procedures

2.1. Patient recruitment

Patients were followed since 2004 by the Memory Consultation group at the CHU IBN ROCHD Neurology Department in Casablanca, Morocco. The protocol was approved by the human ethical committee of the CHU IBN ROCHD in accordance with the declaration of Helsinki for experiments involving humans and written consent was obtained from the patients or their guardians prior to the study.

Seventeen sporadic late –onset AD cases and 8 familial early-onset AD cases were seen at the memory clinic of the Neurology Department of the University of Casablanca Hospital IBN ROCHD. A family history was obtained by a clinical interview of the patient and a "yes" or

"no" self-reporting questionnaire from the guardian or other family member. The disease was considered familial if at least one additional first degree relative suffered from early-onset AD-type dementia. All patients underwent standard somatic neurological examination, cognitive function assessment, brain imaging and laboratory tests.

Assessment of cognitive function varied according to the education level of the subject and it included at least one Mini-Mental State Examination (MMSE), as recommended by the public health high authority. The examination was quoted on thirty points, including investigation of orientation, learning, attention, calculation, immediate memory, language and the ability to execute simple orders (Folstein et al., 1975). The deterioration stages are termed: "light" for scores between 20 and 26; "moderate" for scores between 15 and 19; "moderate severe" for scores between 10 and 14; and "severe" for scores below 10. The MMSE remains the most

used test because it allows for a quick evaluation of cognitive functions and it is required for insanity diagnosis according to the NINCDS-ADRDA criteria. Several elements may modify the assessment tests results, such as the patient's age and sociocultural status, which are important factors to take into consideration when interpreting the test results. In our cases, the questions of the Folstein test were translated orally to the Moroccan dialect, regardless of sociocultural level, to be easily understood. In addition to the MMSE, according to the level of patient education, the clinician used alternative tests that do not require necessarily a level of education such as (BEC96) (Signoret et al., 1988), visual short-term or digital memory assessment, work memory assessment, language assessment test (DO80) (Deloche and Hannequin, 1997) and apraxia.

Brain Magnetic Resonance Imaging (MRI) was routinely performed on all patients. The biochemical assessment consisted mainly of blood analysis for complete blood count, liver, renal and thyroid function, as well as vitamin B12 and B9 serum levels. However, depending on the clinical context, other tests were also performed.

2.2. Genomic studies

Genomic DNA extraction and amplification of the PS1 and PS2 genes.

Genomic DNA was isolated from peripheral blood leukocytes using the salting-out procedure (Miller et al., 1988). In this conventional technique, proteins and other contaminants are precipitated from the cell lysate using high concentrations of salt such as potassium acetate or ammonium acetate. The precipitates are removed by centrifugation and the DNA is recovered by alcohol precipitation. A PCR was performed for the PS1 and PS2 genes (Table1).

2.3. Genomic DNA sequencing and analysis

Direct sequencing was performed for each exon in the PS1 and PS2 genes in 8familial early- onset AD cases ( as below) and 17 sporadic late–onset AD cases:

• The first family case harbors a female (ID P20) with a disease onset age of 60 and a positive family history of EOAD.

• The second family case harbors a female (ID F1) with an onset age of 63 and a positive family history of EOAD

• The third family case harbors a female (ID P32) with a disease onset age of 64 and a family history of AD.

• The fourth family case harbors a male (ID P30) with an onset age of 63 and a family history of AD.

• The fifth patient harbors a male (ID P24) with a disease onset age of 49 and a family history of AD. In addition, the patient’s mother, 75 years of age, was likely afflicted with AD since she showed signs of generalized severe cognitive impairment. Her disease onset age was 66, which was followed by severe dementia 9 years later. Both of the patient’s sisters (non affected members) and the patient’s mother (ID P25) (The sixth affected member) agreed to participate in the study.

• The seventh patient harbors a male (ID F2) with an onset age of 60 and a family history of AD.

• The eighth family case harbors a male (ID F3) with a disease onset age of 55 and a family history of AD.

The others non affected members of families didn't agree to participate which limited our study.

Briefly, Sephadex purified PCR products were sequenced using the Big Dye terminator v3.1 Cycle Sequencing kit (Applied Biosystems). 1000 Genomes was used to study human genetic variations. ANNOVAR, PYTHON and BLAT UCSC programs were used to evaluate these mutations.

3. Results

Sequence analysis of the PS1 and PS2 genes revealed 3 novel frameshift mutations in 3 out of 8 familial early-onset AD cases and none in sporadic cases and healthy controls (Table 2).

3.1. Novel PS1 frameshift insertion

The first novel frameshift mutation 73683837-G at codon 378, which is caused by a single- nucleotide insertion located in exon 11 of PS1, was identified in 68-year-old female (ID F1) with an onset age of 63 and a positive family history of EOAD (figure 1a,1b,1c and 1d).

Neuropsychological examination at the age of 68 showed severe cognitive impairment. The early progressive impairment of episodic memory was noticed 5 years ago. The patient presented a memory and language impairments, aphasia, visio spatial disorientation, decreased autonomy, executive dysfunction and praxis deficits, all leading causes of severe dementia. Neuroimaging revealed hippocampal and parahippocampal atrophy, but the MMSE score was not evaluated as the patient was illiterate, which is the main reason limiting the performance of cognitive assessments and their interpretation, including MMSE. The patient had one living sister who likely had AD, as well as one sister who likely died of AD.

However no post-mortem examination was performed on the deceased.

3.2. Novel PS2 frameshift insertion

The second novel frameshift mutation 227073260-A, which is caused by a single-nucleotide insertion at codon 126 (figure 2a and 2b), located in exon 5 of PS2 (figure 4), was identified

in a 62-year-old male (ID F2). The patient's initial symptom was observed at the age of 60, which was memory loss; the patient showed a difficulty in remembering recently learned facts and inability to acquire new information, while retaining old memories. Followed in our clinic 2 years later, the memory deficit gradually progressed to involve primary progressive aphasia. Neuroimaging revealed hippocampal and parahippocampal atrophy. The MMSE score was 10/30. In addition to the patient, his deceased mother was likely afflicted with AD.

3.3. Novel PS2 frameshift deletion

The third novel frameshift mutation 227079009 A-, which is caused by a single-nucleotide deletion at codon 306 (figure 3a, 3b and 3c), located in exon 9 of PS2 (figure 4), was detected in a family case in a male patient (ID F3) with a disease onset age of 55 and a family history of AD. After a 6-year observation period, the patient had developed severe cognitive impairment and MRI images revealed a cortical atrophy. His MMSE score was evaluated to 5/30 and heshowed a language impairment, aphasia, visio-spatial disorientation, decreased autonomy, executive dysfunction and praxis deficits. Moreover, he became completely dependent upon caregivers and presents unpredictable behavior.

4. Discussion

Alzheimer's disease is caused by the accumulation of amyloid plaque build ups in the brain.

These plaques are partially composed of Aβ, which is a fragment derived from APP. To date, autosomal dominant Familial Alzheimer's Disease (FAD) has been linked to the presence of mutations in three genes APP, PS1, and PS2. The PS1 protein is predicted to be an integral membrane protein with an open reading frame of 467 amino acids (Lehmann et al., 1997).

The PS2 gene has an open reading frame of 448 amino acids and the structural organization of its protein is very similar to that of PS1 (Doan et al., 1996). The genomic organization of the PS2 is identical to PS1. These observations suggest that the PS1 and the PS2 genes are

members of a gene family derived from a common ancestral gene (Levy-Lahad et al., 1996).

All of the mutations in AβPP and in PS1 and PS2 which have been tested are shown to affect AβPP processing such that more Aβ42 is synthesized (Hardy, 1997). Mutations in PS1 and PS2 genes cosegregate with the majority of early-onset familial Alzheimer’s disease (FAD) pedigrees.Several studies suggest that FAD-linked PS1/PS2 variants influence processing at the gamma-secretase site and cause AD by increasing the extracellular concentration of highly amyloidogenic Aβ42 species, thus fostering Aβ deposition in the brain.Presenilin knock-out mice have also proven to be critical for deciphering the role of presenilins in APP metabolism. This evidence that presenilin plays a required role in the gamma-secretase mechanism has received substantial support from several types of experiments (Duff et al., 1996; Citron et al., 1997).

In the current study, we identified 3 novel frameshift mutations located in exon 11 of PS1, in exon 5 and exon 9 of PS2 in familial early-onset AD cases. These frameshift mutations are caused by either an insertion or a deletion of a single-nucleotide in the gene, which changes the reading frame due to a codon shift. An insertion or deletion early in the sequence of a gene results in a more altered protein, which could be abnormally short or long and most likely non-functional (Iannuzzi et al., 1991; Van Den Hurk et al., 2001).

The first mutation that was caused by a single-nucleotide insertion at codon 378 of PS1 was identified in a 68-year-old female (ID F1) with an onset age of 63 and a positive family history of EOAD.

The second mutation that occurs at codon 126 of PS2 was identified in a 62-year-old male (ID F2) with an onset age of 60. The third novel frameshift mutation at codon 306 of PS2 which is caused by a single-nucleotide deletion at codon 306, was detected in a family case in a male patient (ID F3) with a disease onset age of 55 and a family history of AD.

These cases carrying frameshift mutations, had cortical or hippocampal and parahippocampal atrophy accompanied by ventricular extension. Indeed, the hippocampal volume was significantly reduced in patients afflicted with AD as compared to normal subjects. This reduction was approximately 30%-40%. However, despite the lack of accurate quantification of the level of atrophy in our FAD cases, we could conclude that a higher level of atrophy reflects a decrease in neuropsychological performance.

The clinical, neuropathological and genetic assessments of mutated PS1 and PS2 familial AD in our patients have several shared features. For instance, there is a correlation between clinical symptoms and genetic factors in our patients with a family history of AD. Alzheimer's disease is diagnosed over time by repeated clinical reviews revealing the patient's progressive loss of multiple cognitive functions, including memory impairment, which is typically among the first signs of the disease. Indeed, in our study, FAD cases showed a similar clinical presentation which is an impairment in memory which progresses gradually to involve multiple cognitive domains: aphasia, apraxia, agnosia, or executive dysfunction.

Several PS1 mutations have been reported to presente language impairment including G209V, H163Y and R278I, these were detected in one patient that underwent initial clinical diagnosis of progressive non-fluent aphasia (Godbolt et al., 2004). Language deficits have been described in association with many other mutations later in the disease.

Prominent early behavioural symptoms have also been reported in association with several PS2 mutations, including M239V, T122R and Y231C (Marcon et al., 2009). These findings corrrelate with our clinical observations and mutational analysis that suggests these persenilin frameshift mutations may influence the degree of the neuropsychological performances.

On the other hand, PS1 and PS2 mutationsappeare to be causative of EOAD and segregate throughout generations. These make the family history of dementia most consistent risk factor associated with AD. Furthermore, the extent of hippocampal atrophy correlates with overall

severity and memory impairment, which reflects a decrease in neuropsychological performance. The hippocampus is known to be closely involved in memory function.

Longitudinal studies of individuals at risk of FAD demonstrate that the earliest neuropsychological manifestations are a fall in verbal memory and performance IQ scores, occurring even 2-3 years prior to any symptoms (Fox et al., 1998). Presymptomatic cognitive deficits are accompanied by neuroimage changes, with accelerating rates of whole brain and hippocampal atrophy in the five years prior to symptom onset (Scahill et al., 2002; Chan D, et al., 2003; Korf et al., 2004). PS1 and PS2 mutations were associated with a series of pathophysiological changes affecting the Ab42 production and leading to brain amyloid deposition, hippocampal atrophy and progressive cognitive impairment. These findings are in accordance with our clinical observations which report the involvement of presenilin frameshift mutations in our EOAD cases influencing potentially the pathogenesis of neurodegenerative disease.

Moreover, all evaluated frameshift mutations were associated with clinical symptoms of AD, which may explain in part the reason behind the disease in these patients and the disease inheritance throughout the generations. It is worth noting that frameshift mutations are more harmful than base substitution mutations because the outcome of a frameshift mutation is a complete alteration of the amino acid sequence of the protein. This alteration is due to a shift in the reading frame of the transcribed mRNA, which starts at the codon where the mutation occurs. The resulting protein is completely altered or non-functional following mRNA translation by ribosomes.

Accumulating data suggested that presenilin proteins play a role in the gamma-secretase cleavage of Aβ from amyloid precursor protein. PS1 and PS2 are part of the amyloid precursor protein gamma secretase complex and there is evidence that mutations in these

proteins decrease the production of Aβ40 relative to Aβ42 and result in a greater proportion of the more toxic Aβ42 (De Strooper et al., 2012).

Our mutational analysis report a correlation between clinical symptoms and genetic factors in our cases of Early Onset Alzheimer’s Disease (EOAD) .These putative mutations cosegregates with affected family members suggesting a mutagenic effect.

The discovery of further genetic factors involved in the disease could lead not only to development of better diagnostic tools, but to an increased understanding of the disease process. The major challenge is to establish an early diagnosis that would provide better care and better treatment. Although new discoveries are being constantly made the pathogenesis of Alzheimer’s disease remains poorly understood. Our study provides the starting point for genetic studies that would allow the development of a first draft of an integrated vision of the disease process characterization and modeling of genetic mutations responsible for autosomal dominant familial forms of Alzheimer's disease. All these data can now provide an outline of the major pathophysiological stages of Alzheimer's disease, molecular alterations in cognitive impairment. More recently, genetic studies of AD have focused on identifying common variants associated with risk of LOAD through genome-wide association studies. These studies have identified several new genes that show significant association with LOAD, including CLU, BIN1, PICALM and ABCA7 (Harold et al., 2009). Several other potential genes are under investigation including:SORL1 on chromosome 11q23, a protein involved with amyloid precursor protein (APP) trafficking, A2M on chromosome 1234–37, GST01 and GST02 on chromosome 1038, and GAB2 on chromosome 11q14 interacting with the APOE e4 allele. Furthermore, various potential loci are under investigation on the following chromosomes:12, 10, 2q, 9p, and 15q, 19p13, 7q36, 9q22 (UBQLN1) (Bird TD, 2008).

Competing Interests

The authors declare that no competing interests exist.

Funding

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We also thank the Montreal Heart Institute for performing the genetic sequencing of our samples and for analyzing the data. No additional external funding was received for this study.

Acknowledgments

We would like to thank Dr. F.D. Tiziano and all of the scientific staff of the Universita Catholica in Rome, Italy for their help in gene sequencing. We thank Ranbanxy Morocco LCC for their partial financial support to Miss Nadia El Kadmiri. We thank Mr. Othman Rouissi at Ranbanxy Morocco LLC for technical assistance and the staff at the CHU IBN ROCHD Neurology Department in Casablanca. We thank the Laboratory of Medical Genetics and Molecular Pathology, FMPC, Pr Hind Dehbi and Mr. Said Wifaq.

References:

Bertram L, Lill CM, Tanzi RE (2010), The genetics of Alzheimer disease: back to the future.

Neuron 68: 270-281.

Bird TD (2008), Genetic aspects of Alzheimer disease. Genetics IN Medicine 10: 231-237.

Chan D, Janssen JC, Whitwell JL, Watt HC, Jenkins R, Frost C, Rossor MN, Fox NC (2003), Change in rates of cerebral atrophy over time in early-onset Alzheimer's disease: longitudinal MRI study. Lancet 362 : 1121-1122.

Citron M, Westaway D, Xia W, Carlson G, Diehl T, Levesque G, Johnson-Wood K, Lee M, Seubert P, Davis A, Kholodenko D, Motter R, Sherrington R, Perry B, Yao H, Strome R, Lieberburg I, Rommens J, Kim S, Schenk D, Fraser P, St George Hyslop P, Selkoe DJ (1997), Mutant presenilins of Alzheimer’s disease increase production of 42-residue amyloid beta- protein in both transfected cells and transgenic mice. Nat Med: 3: 67–72.

Deloche G, Hannequin D. Test de dénomination orale d’images-DO80, Paris ; ECPA 1997.

De Strooper B, Iwatsubo T, Wolfe MS (2012), Presenilins and γ-secretase: structure, function, and role in Alzheimer Disease. Cold Spring Harb Perspect Med 2: a006304.

Doan A, Thinakaran G, Borchelt DR, Slunt HH, Ratovitsky T, Podlisny M, Selkoe DJ, Seeger M, Gandy SE, Price DL, Sisodia SS(1996), Protein topology of presenilin 1. Neuron 17:

1023-1030.

Duff K, Eckman C, Zehr C, Yu X, Prada CM, Perez-tur J, Hutton M, Buee L, Harigaya Y, Yager D, Morgan D, Gordon MN, Holcomb L, Refolo L, Zenk B, Hardy J, Younkin S (1996), Increased amyloid-beta- 42(43) in brains of mice expressing mutant presenilin-1. Nature 383:710–3.

Folstein M, Folstein S, Mc Hugh P (1975), Mini Mental State ; A practical method for grading the cognitive state patients for the clinician. J Psychiatry Res 12: 189-98.

Fox NC, Warrington EK, Seiffer AL, Agnew SK, Rossor MN (1998), Presymptomatic cognitive deficits in individuals at risk of familial Alzheimer's disease. A longitudinal prospective study. Brain 121 : 1631-1639.

Godbolt AK, Beck JA, Collinge J, Garrard P, Warren JD, Fox NC, Rossor MN. (2004), A presenilin 1 R278I mutation presenting with language impairment. Neurology 63: 1702-1704.

Hardy J (1997), Amyloid, The Presenilins and Alzheimer’s disease. Trends Neurosci 20 :154–

159.

Harold D, Abraham R, Hollingworth P, Sims R, Gerrish A, Hamshere ML, Pahwa JS, Moskvina V, Dowzell K, Williams A, et al.(2009), Genome-wide association study identifies

variants at CLU and PICALM associated with Alzheimer's disease. Nat Genet 41: 1088- 1093.

Iannuzzi MC, Stern RC, Collins FS, Hon CT, Hidaka N, Strong T, Becker L, Drumm ML, White MB, Gerrard B, et al. (1991), Two Frameshift Mutations in the Cystic Fibrosis Gene.

Am J HumGenet 48:227-231.

Korf ES, Wahlund LO, Visser PJ, Scheltens P (2004), Medial temporal lobe atrophy on MRI predicts dementia in patients with mild cognitive impairment. Neurology 63: 94-100.

Lehmann S, Chiesa R, Harris DA (1997), Evidence for sixtransmembrane domain structure of presenilin 1. Journal of Biological. Chemistry 272: 12047-12051.

Lendon CL, Talbot CJ, Craddock NJ, Han SW, Wragg M, Morris JC, Goate AM (1997), Genetic association studies between dementia of the Alzheimer’s type and three receptors for apolipoprotein E in a Caucasian population. Neurosci Lett 222 : 187–190.

Levy-Lahad E, Poorkaj P, Wang K, Fu YH, Oshima J, Mulligan J, Schellenberg GD (1996), Genomic structure and expression of STM2, the chromosome 1 familial Alzheimer disease gene. Genomics 34:198-204.

Marcon G, Di Fede G, Giaccone G, Rossi G, Giovagnoli AR, Maccagnano E, Tagliavini F (2009), A novel Italian presenilin 2 gene mutation with prevalent behavioral phenotype. J Alzheimers Dis 16 : 509-511.

Miller SA, Dykes DD, Polesky HF (1988), A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 3: 1215.

Scahill RI, Schott JM, Stevens JM, Rossor MN, Fox NC (2002), Mapping the evolution of regional atrophy in Alzheimer's disease: unbiased analysis of fluid-registered serial MRI. Proc Natl Acad Sci 99: 4703-4707.

Signoret JL, Bonvarlet M, Benoit N, Bolgert F, Eustache F, Leger JM. In: Batterie d’estimation des états démentiels ; description et validation ; in : D. Leys et H. Petit. La maladie d’Alzheimer et ses limites. Congrès de Psychiatrie et de Neurologie de Langue Française, Masson; 1988. pp 265-270.

Theuns J ,Van Broeckhoven C (2000), Transcriptional regulation of Alzheimer's disease genes: implications for susceptibility. Hum Mol Genet 9: 2383-2394

Van Den Hurk WH, Willems HJ, Bloemen M, Martens GJ (2001), Novel Frameshift Mutations near Short Simple Repeats. The Journal of Biological Chemistry 276: 11496–8.

Figures and tables legends:

Figure1: Identification of a novel frameshift PS1 mutation in a female case (F1).a, Pedigree representing the family history of the case. Symbols: Roman numbers to the left of the pedigrees denote generations. Numbers below the patient symbols denote order of patients.

Arrows indicate the proband. b, DNA sequence electropherograms (exon 11) from control and one affected individual. c, Nucleotide and predicted amino-acid sequence of exon 11, illustrating a single-nucleotide insertion. Amino acid affected is indicated in yellow. d, PS1 protein showing sites of reported mutations. Pathogenic mutations are shown in red. Non- pathogenic mutations are shown in green. Uncertain mutations are showed in orange. Our novel mutation is shown in blue.

Figure 2: Identification of a novel frameshift PS2 mutation in a male case (F2). a, DNA sequence electropherograms (exon5) from control and one affected individual. b, Nucleotide and predicted amino-acid sequence of exon 5, illustrating a single-nucleotide insertion.

Affected amino acid is indicated in yellow.

Figure 3: Identification of a novel frameshift PS2 mutation in a male case (F3).a, Pedigree representing the family history of the case. Symbols: Roman numbers to the left of the pedigrees denote generations. Numbers below the patient symbols denote order of patients.

Arrows indicate the proband. b, DNA sequence electropherograms (exon 9) from control and one affected individual. c, Nucleotide and predicted amino-acid sequence of exon 9, illustrating a single-nucleotide deletion. Affected amino acid is indicated in yellow.

Figure 4: PS2 protein showing sites of reported mutations. Pathogenic mutations are shown in red. Non-pathogenic mutations are shown in green. Uncertain mutations are showed in orange. Our novel mutations are shown in blue.

Table 1: PCR primers sequences of the PS1 and PS2 genes.

Table 2: Phenotypes and genotypes associated with frameshift mutations in EOAD presenilin 1 and presenilin 2 in Moroccan patients with probable AD.

PS-1 Exon Sequence PS-2 Exon Sequence

1 5’TTCTCCCCGCAATCGTTTCTCCAG3’ 1 5’TGTTAGCAGCGGTGTTTG3’

5’GCCCATGTCCGCGGTGCCTTCC3’ 5’TCTGCTCGGAGGGATGGAC3’

2 5’TGGATGACCTGGTGAAATCCTATT3’ 2 5’CAGGGCCAGGGGGAGGAA3’

5’CAGAAAACAAAGCCTCTTGAGGTT3’ 5’AAAAGCAGGTTGGGAGTCAC3’

3 5’ACAAAGTTCTGTTTTTCTTTCCC3’ 3 5’GTCCTCCACTGCCTTTGTCTCAC3’

5’CAGCATTTCTCAGAGGTGAGG3’ 5’CTTCCCTTCTCCCTCCCGCATCAG3’

4 5’CGTTACCTTGATTCTGCTGA3’ 4 5’AAAAATCCGTGCATTACAT3’

5’GACATGCTGTAAAGAAAAGCC3’ 5’GCTGGTTGTGAGCTGCAGGTACAGTG3’

5 5’GATTGGTGAGTTGGGGAAAAGTG3’ 5 5’AGCCTCGAGGAGCAGTCAG3’

5’ATACCCAACCATAAGAAGAACAGG3’ 5’GCAGACGGAGAGAAGCGT3’

6 5’GGTTGTGGGACCTGTTAATT3’ 6 5’GGTATCAGTCTCAGGATCATGGG3’

5’TTAATTCTGAAAGACAGACCC3’ 5’TGGGGAAGACTGGAGCTCGATG3’

7 5’GGAGCCATCACATTATTCTAAA3’ 7 5’GTAAAGAGGGCCAGGTTGGG3’

5’AACAAATTATCAGTCTTGGGTTT3’ 5’GTGCAGCACTGGGGACGATTT3’

8 5’TTACAAGTTTAGCCCATACATTTT3’ 8 5’GGGCAGGCTCTTCTTCAGGG3’

5’TCAAGTTCCCGATAAATTCTAC3’ 5’GAAAGCCACGGCCAGGAAG3’

9 5’TGTGTGTCCAGTGCTTACCTG3’ 9 5’ACCGCCTGAGACGTGAACCTT3’

5’TGTTAGCTTATAACAGTGACCCTG3’ 5’TCCCTCTGCCCCTCCTGAACT3’

10 5’CCAGCTAGTTACAATGACAGC3’ 10 5’CTCTGACCAGCTGTTGTTTC3’

5’TCAAAAAGGTTGATAATGTAGCT3’ 5’AGCCTCCACCCTCTGTCT3’

11 5’GGTTGAGTAGGGCAGTGATA3’ 11 5’TTCCATTCTGTGCACGCCTC3’

5’TTAAAGGGACTGTGTAATCAAAG3’ 5’ACCTGCCCCCACCACAATG3’

12 5’GTCTTTCCCATCTTCTCCAC3’ 12 5’ACACCAGGGATCACCACGCTCAC3’

5’GGGATTCTAACCGCAAATAT3’ 5’TGCCTCCTCCTCACCAAGTAAACA3’

Table 2 : Phenotypes and genotypes associated with frameshift mutations in EOAD PS1 and PS2 in Moroccan patients with probable AD.

Gene Patient

ID Exon Chr Position cDNA mutation (HGVS-style)

Mutation type

Protein changed

Described in ANNOVAR

Sex

Onset Age/Duration

of illness (years)

Family history of

dementia

First clinical symptom(s)

Score

MMSE MRI

PS1 F 1 11 14 73683837 NM_000021:c.1133_1134insG Frameshift p.G378fs No F 63/5 YES Memory

loss Illiterate Atrophy

PS2

F2 5 1 227073260 NM_012486:c.378_379insA Frameshift p.E126fs No M 60/2 YES Memory

loss 10/30 Atrophy F3 9 1 227079009 NM_012486 :c.917delA Frameshift p.K306fs No M 55/6 YES Memory

loss 5/30 Atrophy

Highlights

We identified 1 novel mutation of presenilin 1gene in 1 Moroccan EOAD case .

We detected 2 novel mutations of presenilin 2 gene in 2 Moroccan EOAD cases.

Correlation between clinical Alzheimer's diseasesymptoms and genetic factors