• Aucun résultat trouvé

Detection of intraspecific DNA polymorphism in Streptococcus safivarius subsp, thermophilus by a homologous rDNA probe

N/A
N/A
Protected

Academic year: 2021

Partager "Detection of intraspecific DNA polymorphism in Streptococcus safivarius subsp, thermophilus by a homologous rDNA probe"

Copied!
11
0
0

Texte intégral

(1)

HAL Id: hal-01659168

https://hal.univ-lorraine.fr/hal-01659168

Submitted on 8 Dec 2017

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Detection of intraspecific DNA polymorphism in Streptococcus safivarius subsp, thermophilus by a

homologous rDNA probe

Mireile Pebay, C Colmin, Gérard Guédon, C de Gaspéri, B Decaris, J Simonet

To cite this version:

Mireile Pebay, C Colmin, Gérard Guédon, C de Gaspéri, B Decaris, et al.. Detection of intraspecific DNA polymorphism in Streptococcus safivarius subsp, thermophilus by a homologous rDNA probe.

Research in Microbiology, Elsevier, 1992, 143 (1), pp.37-46. �10.1016/0923-2508(92)90032-J�. �hal-

01659168�

(2)

~) INSTITUT PASTEUR/ELSEVIER Res. Microbiol.

Paris 1992 1992. 143. 37-46

Detection of intraspecific DNA polymorphism in Streptococcus safivarius subsp, thermophilus

by a homologous rDNA probe

M. P6bay (*), C. Colmin, G. G u i d o n , C. De Gasp6ri, B. Decaris and J.M. Simonet Laboratoire de Gdndtique et Microbiologie, Universit# de Nancy I, FaculM des Sciences,

B.P. 239, 54506 Vandceuvre-Ibs-Nancy (France)

SUMMARY

Three ribosomal probes from Streptococcus salivarius subsp, thermophilus were clo- ned. Sequence data demonstrate that their juxtaposition corresponds to an entire ope- ton. They were used in order to study ribosomal operon number and organization, rRNA genes were shown to be clustered in the order 5'-16S-23S-SS-3' and the number of rrn loci to vary within the subspecies. The smallest of the 3 probes was used for strain characterization. Substantial variability in hybridization patterns was observed among strains, resulting not only from, restriction fragment length polymorphism (RFLP) but also from the variability of ribosomal operon number.

Key-words: Operon, rDNA, rRNA, Streptococcus salivarius subsp, therrnophilus ; Genetic polyrnorphism, RFLP, Ribotyping, Probes.

INTRODUCTION

Streptococcus salivarius subsp, thermophilus, designated as S. thermophilus throughout this paper, is a bacterium used in industry as a star- ter in the manufacture of yoghurt and certain types o f cheese. Thus, strain characterization is a point of interest for dairy manufacturers.

Ribotyping has already been used in species, subspecies or biotype identification (Grimont and Grimont, 1986, Grimont et al., 1989, Picard- Pasquier et aL, 1990, Irino et al., 1988, Cox et al., 1990), and this molecular identification system is likely to be adapted to many bacterial species. Ribosomal D N A sequences are suffi-

Submitted May 13, 1991, accepted July 26, 1991.

(*) Corresponding author.

ciently conserved within bacteria to allow the use of a heterologous probe such as Escherichia coil rRNA, although signal intensities are weak and stringency conditions have to be lowered.

Nevertheless, the use of ribosomal probes, is not only of interest in strain characterization but also enables studies of ribosomal operon num- ber and arrangement to be carried out. Indeed, the number of r R N A loci is quite different among eubacteria, ranging from I in slow- growing Myeobacterium species, such as M.

leprae (Sela et al., 1989) to 9 or 10 in Bacillus subtilis, according to strain (Widom et al., 1988).

Moreover, although the arrangement of cluster-

(3)

38

ed genes in the order 5'-16S-23S-5S-3' is that which is most frequently found, it has been shown not to be universal even in eubacteria, e.g.

in Vibrio h a r v e y i t h e l i n k a g e o r d e r is 5'-23S-16S-5S-3' ( L a m f r o m et aL, 1978). In Pirellula marina, the 16S genes are separated from the 23S-5S loci (Liesak a n d S t a c k e b r a n d t , 1989), whereas ill Leptospira interrogans (Fuku- naga et aL, 1989, 1990), the unJqe, e 5S gene is distant from the two 16S-23S clusters (for review, see Krawiec and Riley, 1990).

The use of cloned h o m o l o g o u s .~rn genes has some advantages over that o f heterologous r R N A or r D N A , especially for studies o f ribo- somal operon n u m b e r and organization. Indeed, restriction maps need to be k n o w n for the inter- pretation o f hybridization p a t t e r n s in terms o f the number o f r R N A operons. Moreover, h o m o - logous probes give rise to stronger signals whose i n t e r p r e t a t i o n is less ambiguous.

For this purpose we have cloned r i b o s o m a l fragments, whose juxtaposition corresponds to a n entire composite r R N A o p e r o n . The smaller fragment was entirely sequenced, as were the ends o f the other two. The sequenced probe was hybridized o n a wide sample o f S. thermophi- lus strains including industrial strains, strains from 3 different collections a n d the type strain ATCC19258. A high level o f p o l y m o r p h i s m was observed a m o n g these strains which was s h o w n to be due to b o t h restriction f r a g m e n t length p o l y m o r p h i s m ( R F L P ) a n d variability in the o p e r o n n u m b e r .

M. PI~BA Y E T AL.

cultures in reconstituted milk (10 %). E. coli JM 109 was grown in LB medium.

Preparation of DNA

A modified version of the Marmur (1961) proce- dure was used for the extraction of total streptococ- cal DNA. Modifications consisted mostly of the increase in both lysozyme concentration (15 mg/ml) and time of action (2 h at 37°C). For large scale pre- parations, plasmids from E. coli were extracted by the alkaline lysis method described by Hopwood et eL (1985) and purified on a CsCI gradient. For mini- preparations, the ~lkaline lysis procedure described by Mc~niatis et aL (1982) was used.

Restriction endonuelease digestion analysis Restriction endonucleases purchased from Boeh- ringer Mannheim and New England Biolabs were used according to the suppliers' instructions.

DNA cloning

X h o l fragments of strain NST1403 were ligated into Xhol unique site of "pBluescript KS + ' ' (Stra- tagene). The ligation mixture was used to transform E. coli JM 109 by electroporation according to Dower et al. (1988). Cells were then spread on LB medium supplemented with IPTG (38 ixg/ml), X-Gal (32 i.tg/ml) and ampicillin (50 v.g/ml). Plasmidic content of white colonies was extracted by minipreparation procedure and analysed on gel. Preparative extrac- tions were carried out on the selected clones. Plas- raids suspected of containing ribosomal DNA were hybridized with plasmid pOS113, obtained from J.L.

Pernodet (1985), which contains the entire rrnD ope- ron of Streptomyces ambofaciens.

MATERIALS AND METHODS Bacterial strains and culture media

S. salivarius subsp, thermophilus strains used in this study are listed in table I. They were grown in M17 broth medium supplemented with 5 g/l lactose (Terzaghi and Sandine, 1975) at 42°C from 1 °7o sub-

DNA radiolabelling

Probes were 32p-labelled by nick-translation (Amersham international, Amersham, UK) for plas- raids or by the multiprime DNA-labelling system (Amersham) for DNA fragments purified on agarose gel by the "Geneclean" procedure (Bio 101, La Jolla, CA).

IPTG = isopropyl-[3-t hiogalactopyranoside.

LB = Luria-Bertani (medium).

nt = nucleotide.

RFLP X-Gal

= restriction fragment length polymorphism.

= 5-brorno-4.chloro-3-indolyl-13-D-galactopyranoside.

(4)

rDNA PROBE A N D S. SALIVARIUS subsp. THERMOPHILUS CLONING S o u t h e r n h y b r i d i z a t i o n s

They were carried out as previously described (Larbi et al., 1990). Washings were carried out at 60°C for intraspecific hybridizations, or at 45°C for interspecific ones. "Hyperfilm-MP" (Amersham)

w a s exposed at room temperature or at - 70°C with

intensifying screens for 13 h to 3 days.

D i d e o x y s e q u e n c i n g

The chain-termination method was performed with the "Sequenase 2.0" sequencing kit (USB) and

• -35S-dATP (Amersham). For each set of 4 reactions 1.5 pmol of alkali-denaturated plasmid were anneal-

I 2 3

4 3 x.

3 7 r ~ 17 - - ~ 10.2-- m i d

5 3 - D

6 . 9 - - " - -

ed to 2 pmol of SK c- T3 primer (Stratagene). The labelling and chain-termination steps were carried out in the presence of either dGTP or dITP. Hyperfilm- MP was exposed for 2 or 3 days to soaked and dried gels. Both strands of 14l were sequenced.

RESULTS I d e n t i f i c a t i o n o f r i b o s o m a ! p r o b e s

X h o l fragments from strain NSTI403 were cloned in the unique X h o I site o f plasmid pBluescript KS +. Among the recombinant plas- mids that we obtained, pNST41 was found to contain a 0.53-kb insert, henceforth called I41.

Hybridizations o f pNST41 on c h r o m o s o m a l D N A digests o f straio NST1403 (fig. 1) reveal- ed 5 fragments on Bgtl patterns and 5 fragments on HindllI patterns. Only 3 fragments were observed on Pvull patterns, but one o f them was o f stronger intensity than the other 2. These observations indicated that this fragment was repeated. Moreover, we noticed that fragments o f similar sizes were revealed by plasmid pOS 113 (Pernodet et al., 1985), which contains the entire rrnD locus o f S. ambqfaciens, suggesting that the cloned DNA fragment was a part o f an r R N A locus. Direct hybridization o f I41 on pOS113 gave rise to a strong si.gnal and confirm- ed the hypothesis. Hybridization o f 141 on pOS113 digested with various restriction enzy- mes enabled the identification o f the cloned D N A fragment as a part o f the 23S rDNA gene close to the 3' end (fig. 2).

3 . 8 - - , ~ I I D

3 . 0 ~ D 2 . 6 - . . z ' ~ 2 . 3 - - t [ I D

3 . 6 - - 3 . 3 - -

F i g . 1. A u t o r a d i o g r a m o f strain N S T I 4 0 3 restriction pat- terns h y b r i d i z e d with p N S T 4 1 . M i g r a t i o n t h r o u g h 0.7 % a g a r o s e gei w a s carried out f o r 15 h at l V/crn. L a n e 1) Hindlll p a t t e r n ; lane 2) Bgll pattern; lane 3) Pvull pattern. Fragment sizes are given in kb.

16S 23S 5S

- - [-.\'%~'q K N \ \ \ \ \ \ \ \ \ ~ 1 - . . .

L _ I I I I L . . . I_ J . k _ _ U i

I I I I

143 141 144

5 kb 0.53 kb 7 kb

sequenced regions

Fig. 2. Positions o f [43,141 a n d 144 towards a r i b o s o m a l operon and locations of restriction sites u~cd in this study.

(5)

40 M. P~BA Y E T AL.

1 4 1 C TCGAGCAGGGAC~A,aa~GTCGGGCTTAGTGATC CGGTGGTTCCGTATGGAAGGGCCATCGC TCAACGGATAAAAGC TAC C 8 0

B . s G . . . C . . . S . a G . . . A C . . . C ~ - - G G - T - G . . . C - - - G . . . E . c C - G . . . T G . . . C A - - T - A . . . T - A . . . G - - - T

1 4 1 C T G G G G A T A A C A G G C T T A T C T C C C C C A A G A G T T C A C A T C G A C G G G G A G G T T T G G C A C C T C G A T G T C G G C T C G T C G C A T C C 1 6 0 B . s - C . . . C - C . . . A . . . A . . . S . a - C . . . G . . . . T . . . C . . . A T . . . E . c - C . . . G - - A C - G . . . T - - - T . . . C - G T . . . A - - A . . .

! 4 1 T G G G G C T G T A G T C G G T C C C A A G G G T T G G G C T G T T C G C C C A T T A A A G C G G C A C G C G A G C T G G G T T C A G A A C G T C G T G A G A C 2 4 0 B . s . . . G . . . T . . .

S . a . . . G . . . T . . . T . . . E . c . . . A - - - A . . . A T . . . T . . . T - - T . . . T . . .

I 4 1 A G T T C G G T C C C T A T C C G T C G C G G G C G T A G G A A A T T T G A G A G G A T C T G C T C C T A G T A C G A G A G G A C C A G A G Y • G A C T T A C C 3 2 0 B . s . . . C T . . . G - - - T C - T . . . G - G A . . . G C - - - S . a . . . C T - T - C . . . G T C . . . A - G G - - - T C . . . G - G A C . . . . G A - - - E . c . . . T - C - - T . . . C T - - - G - A C . . . . G - - G G . . . G . . . G C - T -

1 4 1 G C T G G T G T A C C A G T T G T T C T G C C A A G A G C A T C G C T G G G T A G C T A T G T A G G G A A G G G A T A A A C G C T G A A A G C A T C T A A G T G 4 0 0 B . s . . . G . . . G C - - - C . . . G T . . . C A S . a T . . . G . . . C . . . G . . . . G . . . T - G . . . . C - - T C - - G . . . C . . . C - E . c A . . . T - G G . . . C A . . . T G - - - C T - - C C . . . A A - G C . . . A . . . G T . . . C A

1 4 1 T G A A G C C C A C C T C A A G A T G A G A T T T C C C A ~ G A T T T T A T A T C A G T ~ A G A G C C C T G A G A G A T G A T C A G G T T G A T A G G 4 8 0

~ . s . . . C . . . - ~ T C C G C - A G G A - - - ~ - - - T . . . A . . . S . a G . . . T G - T - - G . . . G A C . . . . - ~ C C C C - - G - G G G - T - ~ - - G C T - - - A G T - - - C - - C T G . . . E . c C - - - A - T T G - - C - G . . . T T C . . . . } - - - C C C - T - - A G G - T C C - G I - - - G - A C G - T G A - - - C - - C G - C . . .

1 4 1 T T A G A A G T G G A A G T G T G G T G A C A C A T G T A G C G G A C T A A T A C T A A T A G C T C G A G 5 2 8 B . s - C T - - G . . . C A . . . G - - - T - - - A G . . . C - A . . . S . a C C G - - T C . . . C A C C - C A - G G T G - - G - - G T - - - C G G . . . G C . . . . E . c C C G - G T . . . C - C A - C - - T G - G - T G - - - T A - - C G G . . . G A A C - G T - - -

Fig. 3. Sequence of 141 and its alignment with the corresponding regions of B. subtilis rrnB (B.s), S. ambofaciens rrnD (S a) and E. coli rrnB (E.c).

The framed box corresponds to the hypervariable region (nt 429-444). Dashed lines mean same nucleotide as indicated for I41.

In order to accurately locate the 23S fragment contained in pNST41, the nucleotide sequence o f the cloned D N A fragment was established (fig. 3) and compared with the corresponding B.

subtilis rrnB (Green et al., 1985), S. ambofaciens rrnD (Pernodet et aL, 1985) and E. coli rrnB (Brosius et al., 1981) sequences. This enabled the identification of 141 as the fragment correspond- ing to the interval nt 2362 to 2894 o f 23S r R N A of E. coli. Percentages of homology between I41 and the corresponding sequences from B. sub- tiffs, S. ambofaciens and E. coli were 90.2, 81.3 and 76.6 °70, respectively, and were in accor- dance with the generally accepted phylogeny (Stackebrandt and Teuber, 1988). Although homology between these sequences taken as a whole was very strong, it was not evenly distri- buted and the presence of a hypervariable region was noticed from nt 429 to nt 444 of our num-

bering, corresponding to the 2789-2806 helix of E. coli 23S r R N A (Noller, 1984). The G + C % o f the whole sequence was 53 o70. This is quite a high value for S. t h e r m o p h i l u s whose total G + C contents ranges from 37.2 to 39.8 °7o (Far- row and Collins, 1984). This is in accordance with the general observation that G + C contents o f r R N A genes are not as variable as those of total genomes, probably reflecting sequence con- servation of rDNA.

Another recombinant plasmid, pNST43, con- taining a 5-kb insert called I43, which, when used as a probe on chromosomal Bgll digests, reveal- ed the 5 bands already revealed by I41. Insert I43 did not cross-hybridize with 141, but it did with pOS113. Hybridization o f I43 on various digestions o f pOS 113 showed that I43 contained a 16S gene and part of the adjacent 23S gene.

Insert 143 ends were sequenced. Comparison

(6)

rDNA PROBE A N D S, SALIVARIUS subsp. THERMOPHILUS CLONING 41 with other published sequences showed that I43

was strictly contiguous to one o f the I41 copies, as its o t h e r end was located upstream o f the 5' end o f 16S (fig. 2).

Plasmid pNST44 contained a 7-kb insert, cal- led I44, which did not hybridize with I41, I43 or p O S l l 3 , whereas it hybridized on all the H i n d l l I fragments already revealed by I41.

A m o n g the fragments revealed by b o t h I41 and 144, only one was o f strong intensity, the others were weaker. This result showed t h a t a part o f I44 was present only once in the S. thermophi- lus genome, a n o t h e r part being repeated close to each I41 copy a n d so weakly revealing all I41 copies. By sequencing its end, it was f o u n d to be exactly contiguous to one o f the I41 copies a n d to contain the last 15 bp o f a 23S r D N A , a 84-bp long spacer, a n d t h e n a 5S r D N A gene (fig. 2).

T h e fact t h a t 143 contains a 16S r R N A gene a n d a part o f the adjacent 23S r D N A gene, t h a t 141 contains a part o f a 23S r R N A gene, t h a t 144 contains the last few bases o f a 23S r R N A gene a n d a 5S r R N A gene a n d t h a t these 3 frag- m e n t s are h o m o l o g o u s to strictly contiguous

~equences, shows t h a t the j u x t a p o s i t i o n o f the 3 cloned D N A fragments in the order I43-I41-I44 represents a n entire rrn o p e r o n , with the most f r e q u e n t l y f o u n d a r r a n g e m e n t b e i n g 5'-16S-23S-5S-3' (fig. 2). Indeed, a l t h o u g h the 3 fragments were not cloned from the same ope- ron, since every f r a g m e n t revealed by I41 was also revealed by b o t h I43 a n d 144, it implies that all the operons o f strain NSTI403 are likely to c o n t a i n 16S, 23S a n d 5S genes.

Ribosomal operon number

Hybridization o f 141 on strain NSTI403 HindlII pattern (fig. 1) revealed 5 fragments with similar intensity. According to their size (the big- gest was 5.3 kb long), these fragments could not contain more t h a n one ribosomal cperon. Since n o HindlII site was f o u n d in I4!, either by HindlII digestion or by sequencing, it is very likely t h a t I41 has 5 copies in the NSTI403 genome. This hypothesis was confirmed by the

BglI hybridization profile in which 5 signals were also observed. The fact t h a t only 3 spots were revealed on the PvulI pattern is compatible with this result because o f the higher intensity o f the 3.3-kb signal which may be a triple signal.

We therefore considered whether the I41 copy n u m b e r was identical to the n u m b e r o f whole ribosomal operons. For this purpose we used another probe, I43, which has one P v u l l and one HindlIl site. According to the restriction m a p o f this region, the n u m b e r o f fragments reveal- ed by I43 was expected to be twice the n u m b e r o f fragments revealed by I41. Indeed, I43 reveal- ed 5 more b a n d s o n P v u l I or H?ndlII c h r o m o - somal digests t h a n did I41 (data not shown).

These results confirmed the fact that strain NST1403 contained 5 r D N A operons.

In order to establish whether the n u m b e r o f ribosomal operons was constant within the subs- pecies S. thermophilus, similar work was carried out on a wide sample o f strains o f various ori- gin: strains from 3 collections, including the type strain ATCC19258, a n d industrial strains (table I). Hybridization o f I41 on HindlII pat-

Table I. S. thermophilus strains used in this study.

Strains Origin

ATCC19258, ATCC19987 ATCC CNRZ7, CNRZ160,

CNRZ302, CNRZ307, CNRZ308, CNRZ368, CNRZ385, CNRZ388, CNRZ391, CNRZ445,

CNRZ455 CNRZ

CIP663 I, CIP6757 CIP A054 (*), NSTI, NST5, NST7, NST10, NSTll, NSTI2

NST 1403

Industrial strains Obtained in the labo- ratory by subcloning strain CNRZ368 ATCC = American Type Culture Collection. Rockeville, MD (USA).

CNRZ = Centre National de la Recherche Zootechnique, Jouy-en-Josas. (France).

CIP = Collection de I'Institut Pasteur, Paris (France).

(*) Kindly provided by Dr. A. Mercenier.

(7)

M. P ~ B A Y

k b A B C D E F

6.0 5 . 3

3 . 8

3 . 0 2.6 2 . 3

Fig. 4. Autoradiogram of HindllI digests of various S.

thermophilus hybridized with pNST41.

Migration through 0.8 % agarose gel was carried out for 15 h at 1 V/cm. Lanes are lettered according to table II. Lane A = NSTI403; lane B = CNRZ368; lane C = ATCC19258; lane D = CNRZ307; lane E = IP6631 ; lane F = CNRZ391.

E T A L .

t e r n s w a s realized f o r 23 s t r a i n s a n d 6 t y p e s o f p a t t e r n w e r e o b s e r v e d (fig. 4 a n d t a b l e II).

G r o u p B w a s m a d e u p o f 16 s t r a i n s w h i c h exhibited t h e s a m e h y b r i d i z a t i o n p a t t e r n c o n s i s t - i n g o f 6 b a n d s o f s i m i l a r i n t e n s i t y , 2.3, 2.6, 3.0, 3.8, 5.3 a n d 6 k b , r e s p e c t i v e l y . I n s t r a i n C N R Z 3 9 1 ( g r o u p F), a f r a g m e n t o f 2 . 3 5 - k b a p p e a r e d i n s t e a d o f t h e 2 . 3 - k b f r a g m e n t . S t r a i n C N R Z 3 0 7 ( g r o u p D) l a c k e d t h e 2 . 3 - k b b a n d b u t t h e 3 . 8 - k b s i g n a l w a s o f d o u b l e i n t e n s i t y . I n s t r a i n IP6631 ( g r o u p E), t h e p a t t e r n w a s q u i t e d i f f e r e n t , a l t h o u g h 6 f r a g m e n t s were also reveal- e d w h i c h w e r e 2.5, 2 . 6 5 , 2.7, 3 . 3 5 , 5 . 4 a n d 6 k b l o n g . H e n c e , in t h e s e 20 s t r a i n s , t h e I41 c o p y n u m b e r w a s 6, a l t h o u g h ~ve h a d n o d i r e c t i n d i - c a t i o n t h a t t h e 6 c o p i e s w e r e i d e n t i c a l .

C o n v e r s e l y , in t h e 3 s t r a i n s o f g r o u p A ( C N R Z 7 , N S T 1 4 0 3 a n d A 0 5 4 ) , t h e I41 c o p y n u m b e r w a s 5. I n d e e d , f r a g m e n t sizes were i d e n - tical t o t h o s e o f g r o u p B, b u t t h e 6 - k b f r a g m e n t w a s m i s s i n g a n d all t h e s i g n a l s w e r e o f s i m i l a r i n t e n s i t y . I n s t r a i n A T C C 1 9 2 5 8 ( g r o u p C), o n l y

1 a b

~ b

9,4

6 , 6 - * - 4 ~,

4 . 4

i I

2 . 3 I 2 . 0 -

c d e f g h i j

I o

Q I ~ I m

N I

a I I I I B

Fig. 5. Autoradiogram of Pvull digests of various S. thermophilus hybridized with pNST41.

Migration through 0.8 % agarose gel was carried out for 17 h at l V/cm. Lanes are lettered accord- ing to table II. Lane I : Hindlll digested ~. DNA. Lane a = ATCC19258 ; lane b = CNRZ385 ; lane c = NSTII ; lane d = CNRZ307; lane e = CNRZ308; lane f = CNRZ391 ; lane g = CNRZ445;

lane h = NSTI403; lane i = 1P663t; lane j = ATCC19987.

(8)

rDNA PROBE A N D S. SALIVARIUS subsp. THERMOPHILUS CLONING 43 4 fragments were revealed, which were 2.5, 2.6,

2.9 a n d 3.8 kb long. This pattern was quite dif- ferent f r o m the others, the two bands c o m m o n to this strain and the others were the 2.6-kb and the 3.8-kb fragments.

In order to determine whether each sequence homologous to I41 was included in a whole ribo- somal o p e r o n , the 143 p r o b e was hybridized on the HindlII pattern o f at least one strain o f each group. Groups C and E excepted, the results that were obtained with this p r o b e were consistent with those obtained with 141 a n d gave evidence for the presence o f 5 r R N A o p e r o n s in group A (strains CNRZ7, NSTI403 a n d A054) and 6 r R N A operons in groups B, D and F. In the case o f strain ATCC19258 (group C), 5 additional signals were observed on Hind!II patterns hybri- dized with I43 instead o f the 4 expected. This could be due to the presence o f a HindlII site in o n e o f the sequences h o m o l o g o u s to I43 in strain ATCC19258. A n o t h e r explanation could be that two operons close together are inverted,

and so, two sequences homologous to I41 would be on the same HindlII fragment. A third pos- sibility could be the presence o f a truncated ope- r o n in strain ATCC19258, p e r h a p s only constituted by the 16S r D N A gene. In the case o f strain IP6631 (group E), only two v e r j strong additional signals o f 3.8 and 6 kb were observ- ed on HindlII patterns hybridized with I43, ins- tead o f the 6 expected. This could be explained by the co-migration o f several I43 homologous sequences, perhaps indicating the presence o f conserved sequences upstream o f the 16S genes.

Intraspecific polymorphism

I41 was used as a probe on P v u l I and Bgll restriction patterns o f 23 strains in our labora- tory collection, co-migrations were realized to enable discrimination between bands o f close molecular weight. Ten different P v u l I patterns were revealed (fig. 5, table II). All but one shar-

Table II. Classification of strains among Pvull, BglI and HindllI groups based on 141 hybridization patterns.

141 copy

Strains Hindlll Pvull Bgll number Final group

CNRZ7 A c 10 5 I

NSTI403 A h 9 5 II

AO54 A h 9 5 II

NSTI B h 8 6 Ill

CNRZ368 B h 7 6 IV

CNRZ385 B b 12 6 V

CNRZ455 B c 12 6 VI

CNRZ302 B c 2 6 VII

CNRZ3g8 B c 11 6 VIII

NSTI 1 B c 11 6 VIII

NSTI2 B c 4 6 IX

CIP6757 B c 5 6 X

NST5 B c 5 6 X

NST7 B c 5 6 X

NST10 B c 5 6 X

CNRZI60 B c 5 6 X

CNRZ308 B e 13 6 XI

ATCC19987 B j 16 6 XII

CNRZZl-45 B g 3 6 XIII

ATCC 19258 C a 6 4 XIV

CNRZ307 D d 1 6 XV

CIP6631 E i 14 6 XVI

CNRZ391 F f 15 6 XVII

(9)

M. PF.BA Y E T AL.

ed a signal at 3.3 kb whose intensity was gene- rally stronger than that o f the other bands, indi- cating that this band was double, triple or even more. The only exception was CNRZ385 which lacked this fragment, but the whole PvulI pat- tern of this strain was o f a higher molecular weight than that of the other strains. As this enzyme is methylation-sensitive (inhibited by the methylation of the internal cytosine of the reco- gnition sequence 5 ' C A G C T G Y ) , differences in P v u l l hybridization patterns between strain CNRZ385 and the other strains have to be con- sidered in terms o f methylation instead of nucleotide sequence variability.

Strains ATCC19258, ATCC19987, IP6631, CNRZ445, CNRZ391, CNRZ308 and CNRZ307 also had their own PvulI hybridization patterns, and each of them constituted a group on its own (table It). Conversely, the " c " group was cons- tituted by tea stra;.ns with identical patterns. As regards the " h " group, it contained 4 strains CNRZ368, NST1, A054 and NST 1403 which did not have the same 141 cop3. number. The most probable explanation of the fact that NSTI403 and A054 apparently have the same PvulI pat- tern as CNRZ368 and NST1, in spite o f the dif- ferent 141 copy number, is that the missing operon corresponds to an additional copy of the 3.3-kb fragment.

Similar experiments were carried out by hybridization of I41 on Bgll patterns. The results are summarized in table II. Compilation of Hin- d i l l , PvulI and Bgll groupings permitted us to define 17 groups for the 23 studied strains (table II). As most of these only contained 1 strain, it is to be expected that some new patterns may be observed if other strains were tested. These results indicate a very large variability between strains of S. thermophilus resulting from both variation in trn loci number and R F L P detect- ed by ribosomal probes.

DISCUSSION

Although ribotyping has already been used in species, subspecies or type identification, such a large variability between strains of a given spe- cies, as in the present study, has rarely been

reported. This observation may be due, at least in part, to the choice o f restriction enzymes we used. Indeed, it can be noted that R F L P was much more substantial on Bgh patterns than on HindIII and PvuII ones. The former enzyme does not have any sites within the ribosomal ope- rons and generates large fragments, often grea- ter than 15 kb, whereas the latter enzymes each have one site and generate smaller fragments.

Thus, it can be expected that R F L P is the result o f extraribosomal rather than intraribosomal sequence variability. However, as many strains have their own hybridization profiles, and as very few strains were found to share the same hybridization pattern, I41 can be used as a powerful tool in strain identification; this is par- t-;cularly important for industrial microor- ganisms.

In a previous report (Colmin et al., 1991), we described pNST21, a species-specific probe from S. thermophilus which also detects R F L P . Although at this time and with the strains that we tested, pNST21 does not discriminate bet- ween strains belonging to the same I41 group, the use o f these two probes will enable rapid and easy identification of a strain such as S. ther- mophilus and its accurate characterization.

Another important point to consider is that the ribosomal operon number varies within S.

thermophilus, although we do i~.ot know whe- ther all of them are functional. As rrn loci are repeated in the genome, they can serve as sites for intrachromosomal homologous recombina- tion, giving rise to duplications, deletions or inversions as already described for B. subtilis (Widom et al., 1988) and E. coli (Hill et al., 1990). Variations in the number o f operons can result either from deletions or duplications. In S. thermophilus, most strains exhibit 6 o f them and a few others only 5 (strains of groups I and 1I). Moreover, strain NSTI403 which has only 5 rrn loci derives from strain CNRZ368 which has 6 of them. Thus, the most probable expla- nation is that typical strains of S. thermophilus have 6 rrn loci and that the others are deleted mutants. In the case of strain ATCC19258, the number of operons seems to be 4 or 5, perhaps in ~u atypical arrangement. Moreover, hybridi-

(10)

rDNA P R O B E A N D S, S A L i V A R I U S subsp. T H E R M O P H 1 L U S C L O N I N G z a t i o n p a t t e r n s o f t h i s s t r a i n a r e r a t h e r d i f f e r e n t

f r o m t h o s e o f o t h e r s t r a i n s , s h a r i n g few b a n d s w i t h t h e m , a n d t h u s t h i s t y p e s t r a i n d o e s n o t s e e m to be r e p r e s e n t a t i v e o f S. thermophilus, at ieagt w i t h r e g a r d to r i b o s o m a l g e n e s ,

I n S. thermophilus, R F L P is q u i t e m a r k e d s i n c e 18 g r o u p s h a v e b e e n e s t a b l i s h e d a m o n g t h e 24 t e s t e d s t r a i n s . M o r e o v e r , real R F L P is e v e n g r e a t e r t h a n t h a t d e t e c t e d w i t h r i b o s o m a l p r o - bes, a n d s o m e s t r a i n s b e l o n g i n g to t h e s a m e final g r o u p c a n be d i s t i n g u i s h e d o n t h e b a s i s o f t h e i r r e s t r i c t i o n p r o f i l e ( u n p u b l i s h e d results). G e n e - rally s p e a k i n g , R F L P c o u l d r e s u l t e i t h e r f r o m p o i n t m u t a t i o n s altering restriction sites o r f r o m c h r o m o s o m a l r e a r r a n g e m e n t s . I n fact, o n e rear- r a n g e m e n t w o u l d m o d i f y t h e l e n g t h o f m a n y m o r e restriction f r a g m e n t s t h a n o n e p o i n t m u t a - t i o n , a n d s o R F L P is m o r e likely to r e s u l t f r o m g e n o m i c plasticity t h a n f r o m n u c l e o t i d e s e q u e n c e v a r i a b i l i t y .

Detection du polymorphisme ADN intrasp~cifique chez Streptococcus salivarius subsp, therraophilus

par une sonde ADNr homologue Trois sondes ribosomiques de Streptococcus sali- varius subsp, thermophilus ont 6t6 clon6es. Des r6sul- tats de s~quenc;age montrent que leur juxtaposition correspond ~ u n op6ron entier. Eilcs ont 6t6 utilis~es pour ~tudier le n o m b r e et l'organisation des op6rons ribosomiques. Les g~nes d ' A R N r sont group6s dans l'ordre 5'-16S-23S-5S-3' et le nombre de loci rrn varie /l I'int~rieur de la sous-esp~ce. La plus petite des trois sondes a 6t~ utilis~e en vue de caract6riser les sou- ches. U n e grande variabilit6 des profils d'hybrida- tion a 6t6 observ6e entre les souches, r6soltant non seulement du RFLP, mais aussi de la variabilit6 dans le n o m b r e d'op6rons ribosomiques.

Mots-clds: Op~eon, ADNr, ARNr, Streptococcus salivarius sbsp. thermophilus; Polymorphisme g~n6- tique, R F L P , Ribotypage, Sondes.

References

Brosius, J., Dull, T.3., Sleeter, D.D. & Noller, H.F. (1981), Gene organization and primary structure of a ribo- somal RNA operon from Escherichia coil J. tool BioL, 148, 107-127.

45 Colmin, C., P~bay, M., Simonet, J.M. & Decaris, B.

(1991), A species-specific DNA probe obtained from Streptococcus salivarius subsp, thermophilus detects strain restriction polymorphism. FEMS ~VIicrobiol.

Letters, 81, 123-128.

Cox, N., Johnston, J., Szarka, Z., Wright, D.J. &

Archard, L.C. (1990), Characterization of an rRNA- gene-specific cDNA probe: applications in bacterial identification. J. gen. MicrobioL, 136, 1639-1643.

Dower, W.J., Miller, J.F. & Ragsdale, C.W. (1988), High efficiency of E. coli by high-voltage electroporation.

Nucl. Acids Res., 16, 6127-6145.

Farrow, J.A.E. & Collins, M.D. (1984), DNA base com- position, DNA-DNA homology and long-chain fatty acid studies on Streptococcus thermophilus and Strep- tococcus salivarius. J. gen. MicrobioL, 130, 357-362.

Fukunaga, M. & Mifuchi, I. (1989), Unique organization of Leptospira interrogans rRNA genes. J. Bact., 171, 5763-5767.

Fukunaga, M., Horie, I. & Mifuchi, I. (1990), Isolation and characterization of the 5S rDNA gene of Lep- tospira interrogans. J. Bact., 172, 3264-3268.

Green, C.J., Stewart, G.C., Hollis, M.A., Void, B.S. &

Bott, K.F. (1985), Nucleotide sequence of the Bacil- lus subtilis ribosomal RNA operon, rrnB. Gene, 37, 261-266.

Grimont, F. & Grimont, P.A.D. (1986), Ribosomal ribo- nucleic acid gene restriction patterns as potential taxo- nomic tools. Ann. Inst. Pasteur/MicrobioL, 137B, 165-175.

Grimont, F., Lef~vre, M., Ageron, E. & Grimont, P.A.D.

(1989), rRNA gene restriction patterns of Legionella species: a molecular identification system. Res. Micro- biol., 140, 615-626.

Hill, C.W., Harvey, S. & Gray, J.A. (1990), Recombina- tion between rRNA genes in Escherichia coli and Salmonella typhimurium, in "The bacterial chromo- some" (K. Drlica and M. Riley) (pp. 335-340). Ame- rican Society for /Vlicrobiology, Washington, D.C.

Hopwood, D.A., Bibb, M.J., Cbater, K.F., Kieser, T., Bruton, C,J., Kieser, H.M., Lydiate, D.J., Smith, C.P., Ward, J.M. & Schrempf, H. (1985), Genetic manipulation of Streptomyces: a laboratory manual.

The John Innes Institute. Norwich.

Irino, K., Grimont, F., Casin, I., Grimont, P.A.D. & the Brazilian Purpuric Fever Study Group (1988), rRNA gene restriction patterns of Haemophilus influenzae biogroup Aegyptius strains associated with Brazilian purpuric fever. J. clin. Microbiol., 26, 1535-1538.

Krawiec, S. & Riley, M. (1990), Organization of the bac- terial chromosome. MicrobioL Rev., 54, 502-539.

Lamfroln, H., Sarabhai, A. & Abelson, J. (1978L Cloning Beneclcea genes in Escherichia coli. J. Bact., 133, 354-363.

Larbi, D., Colmin, C., Rousselle, L., Decaris, B. & Simo- net, J.M. (1990), Genetic and biological characteri- zation of nine S. thermophilus bacteriophages. Le Lait. 70, 107-116.

Liesack, W. & Stackebrandt, E. (1989), Evidence for unlinked rrn operons in the planctomycete Pirellula marina. J. Bact., 17, 5025-5030.

Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982), Moic- cular cloning : a laboratory manual. Cold Spring Har- bor Laboratory, New York.

Marmur, J. (1961), A procedure for the isolation of deoxy-

(11)

M. P ~ B A Y E T A L . ribonuclic acid from microorganisms. J. mol. BioL, 3, 208-218.

Noller, H.F. (1984), Structure of ribosomal DNA. Ann.

Rev. Biochem., 53, 119-162.

Pernodet, J.L., Boccard, F., Alegre, M.T., Gagnat, J. &

Gaerineau, M. (1985), Organisation and nueleotide sequence of a ribosomal gene cluster from Streptomy- ces ambofaciens. Gene, 79, 33-46.

Picard-Pasquier, N., Pieard, B., Heeralal, S., Krishna- m•orthy, R. & Goullet, P. (1990), Correlation bet- ween ribosomal DNA polymorphism and electrophoretic enzyme polymorphism in Yersinia.

J. gen. Microbiol., 136, 1655-1666.

Sela, S., Clark-Curtiss, J.E. & Bercovier, H. (1989), Characterization and taxonomic implications of the rRNA genes of Mycobacterium leprae. J. Bact., 171, 70-73.

Stackebrandt, E. & Teuber, M. (1988), Molecular taxo- nomy and phylogenetic position of lactic acid bacte- ria. Biochimie, 70, 317-324.

Terzaghi, B.E. & Sandine, W.E. (1975), Improved medium for lactic streptococci and their bacteriophages. Appl.

Microbiol., 29, 807-813.

Widom, R.L., Jarvis, E.D., LaFauci, G. & Rudner, R.

(1988), Instability of rRNA operons in Bacillus sub- tills. J. BacL, 170, 605-610.

Références

Documents relatifs

A first relevant outcome is the concordance of our nuclear phylo- geny with earlier inferences based on plastid data for the relationships among the three major clades of

In order to characterize the strains in the CIRAD collection, we developed a rapid discriminant analysis method based on analysing the diversity of partial ribosomal DNA

...Des images fugaces Quand on perd son amour Tout devient translucide Sans relief ni couleurs On pleure sur son sort Mais c'est bien pire encore Que d'être en Alzheimer Que de

de recherche/buts Les objectifs de cette étude sont : -!de déterminer dans quelle mesure les infirmières exerçant en milieu de soins aigus et prenant en charge des personnes

The diversity within biovar 1 appeared to be correlated with geographic origin since all strains belonging to cluster VII were isolated from Africa, mainly from the southern

DNA extracted directly from nodules was used to assess the genetic diversity of Frankia strains symbiotically associated with two species of the genus Casuarina and two of the

Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. congolensis,

Chaque trimestre, cet indicateur est calculé comme le rapport entre les sorties des listes au cours des douze derniers mois (mesuré par la variation sur un an du stock de