HAL Id: hal-03001768
https://hal.archives-ouvertes.fr/hal-03001768
Submitted on 18 Nov 2020HAL is a multi-disciplinary open access
archive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Two novel Rickettsia species of soft ticks in North
Africa: ‘Candidatus Rickettsia africaseptentrionalis’ and
‘Candidatus Rickettsia mauretanica’
Marie Buysse, Olivier Duron
To cite this version:
Marie Buysse, Olivier Duron. Two novel Rickettsia species of soft ticks in North Africa: ‘Candida-tus Rickettsia africaseptentrionalis’ and ‘Candida‘Candida-tus Rickettsia mauretanica’. Ticks and Tick-Borne Diseases, 2020, 11 (3), pp.101376. �10.1016/j.ttbdis.2020.101376�. �hal-03001768�
1
Two novel Rickettsia species of soft ticks in North Africa: ‘Candidatus
1
Rickettsia africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’
2 3
Marie Buysse1 and Olivier Duron1* 4
5
1 Laboratoire Maladies Infectieuses et Vecteurs : Ecologie, Génétique, Evolution et Contrôle 6
(MIVEGEC), Centre National de la Recherche Scientifique (CNRS) - Institut pour la 7
Recherche et le Développement (IRD) - Université de Montpellier (UM), 911 Avenue 8
Agropolis, F-34394 Montpellier, France 9
* Correspondence: olivier.duron@ird.fr 10
2
Abstract
11
Rickettsia are obligate intracellular bacteria often associated with hard ticks but more rarely 12
with soft ticks. In this study, we detected two putative novel Rickettsia species in three soft 13
species from North Africa: Ornithodoros occidentalis from Morocco, Ornithodoros erraticus 14
from Algeria and Ornithodoros normandi from Tunisia. We characterized these two novel 15
Rickettsia species on the basis of comparative DNA sequence analyses and phylogenetics of 16
four genes (gltA, 16S rRNA, coxA and ompB). These Rickettsia, provisionally named 17
‘Candidatus Rickettsia africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’, differed 18
in nucleotide sequence from those of other Rickettsia species by 0.14–21.43% depending on 19
the gene examined. Phylogenetics further showed that the two novel Rickettsia species are 20
closely related to each other and represent sister taxa to R. hoogstraalii, R. felis and R. 21
asemboensis within the transitional Rickettsia group. While Ornithodoros host species of 22
‘Candidatus Rickettsia africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’ are 23
among the most common soft ticks to bite humans, their pathogenicity remains to be 24 investigated. 25 26 Key words 27
Soft ticks; Ornithodoros; Rickettsia; North Africa 28
3
1. Introduction
29
Members of the genus Rickettsia are obligate intracellular bacteria infecting eukaryotes. There 30
are currently more than 30 recognized species but the advent of multilocus sequence typing 31
(MLST) and molecular phylogenetics has recently led to the description of several new 32
putative species (Labruna, 2009; Parola et al., 2005; Weinert, 2015; Weinert et al., 2009). 33
Nowadays, the best known Rickettsia species are the causative agents of severe diseases in 34
humans and other mammals, including Rocky Mountain spotted fever and epidemic typhus 35
(Parola et al., 2005; Perlman et al., 2006; Weinert, 2015). These Rickettsia species are all 36
associated with blood-feeding arthropods (ticks, mites, lice and fleas) which widely transmit 37
infections to vertebrates. However, not all Rickettsia are pathogens since many are 38
exclusively found in arthropods (e.g., ladybirds, spiders and book lice) in which they undergo 39
maternal (transovarial) transmission to offspring (Behar et al., 2010; Gottlieb et al., 2006; 40
Perlman et al., 2006; Weinert et al., 2009), as exemplified with R. buchneri in the blacklegged 41
tick Ixodes scapularis (Kurtti et al., 2015). 42
43
In recent years, Rickettsia spp. have been discovered in a diverse range of hosts, but hard ticks 44
(Ixodid) remain undoubtedly among the main arthropod hosts (Labruna, 2009; Perlman et al., 45
2006; Weinert et al., 2015, 2009). By contrast, only a few Rickettsia have been reported from 46
few soft ticks (Argasid): this includes R. bellii and R. hoogstraalii, which are both regularly 47
identified in Argas spp. and Ornithodoros spp., but also the R. wissemanii, R. nicoyana, R. 48
lusitianiae and undetermined species, which are known only from a few Ornithodoros and 49
Argas species (Duh et al., 2010; Duron et al., 2018; Hornok et al., 2019; Milhano et al., 2014; 50
Moreira-Soto et al., 2017; Sánchez-Montes et al., 2016; Tahir et al., 2016; Yan et al., 2019). 51
In a recent study, Duron et al. (2017) examined a collection of 26 soft tick species and 52
detected infection by Rickettsia in one Argas and 15 Ornithodoros species. While some of 53
these Rickettsia infections were not assigned to known species, examination of gltA 54
4 phylogeny showed that most of them were closely related to R. lusitianiae and R. bellii
55
(Duron et al., 2017). 56
57
In this paper, we report on the discovery of two putative new species of Rickettsia in nymphs 58
of three soft tick species from North Africa: O. occidentalis from Morocco, O. erraticus from 59
Algeria and O. normandi from Tunisia. We used MLST gene sequences, including gltA, coxA, 60
ompB and 16S rRNA, and phylogenetics for the description of these infections. We further 61
examined their genetic proximity with known Rickettsia species and strains. 62
63
2. Materials and Methods
64
2.1. Tick DNA collection 65
Our preliminary examination of the gltA Rickettsia sequences obtained from soft ticks by 66
Duron et al. (2017) showed that six sequences (GenBank accession numbers: O. erraticus, 67
KY678045; O. normandi, KY678051; O. occidentalis, pending) cannot be assigned to known 68
Rickettsia species and strains, as we detailed below in the Results section. These six gltA 69
Rickettsia sequences were obtained from nymphs of O. occidentalis from Morocco (locality 70
Fez, 2010: n=3; locality Taza, 2010: n=1), O. erraticus from Algeria (locality Taher, 2010: 71
n=1) and O. normandi from Tunisia (locality Bizerte, 2010: n=1). The two most distant 72
localities (Fez and Bizerte) are approximately 1000 km apart. These six nymphs were 73
primarily collected through the examination of rodent burrows (Trape et al., 2013). They were 74
further individually washed in three sterile water baths, air dried and collected in sterile 75
microtubes. DNA was individually crushed by shaking with a bead beater (mixer mill 76
MM301, Qiagen, Hilden, Germany), and then DNA was isolated and purified using the 77
DNeasy Blood and Tissue Extraction Kit (Qiagen) following the manufacturer’s instructions 78
as described in Trape et al., 2013. 79
5 2.2. Molecular typing
81
DNA templates of the six nymphs mentioned above were used for Rickettsia molecular 82
typing. Along with the gltA gene already sequenced, we amplified three other genes, 16S 83
rRNA, coxA, ompB, using nested or nested PCR assays (Table 1). The use of semi-84
nested or nested PCR was efficient at decreasing the probability of contamination from 85
unwanted amplification products (false positives). To prevent possible contamination, 86
different parts of this process were physically separated from one another, in entirely separate 87
rooms. All amplicons were also sequenced to control for false positive amplifications. Gene 88
features, primers and PCR conditions are detailed in Table 1. 89
90
Semi-nested and nested PCR amplifications were performed as follows: the first PCR run 91
with the external primers was performed in a 10 μL volume containing ca. 20 ng of genomic 92
DNA, 3 mM of each dNTP (Thermo Scientific), 8 mM of MgCl2 (Roche Diagnostics), 3 μM 93
of each primer, 1 μL of 10X PCR buffer (Roche Diagnostics), and 0.5 U of Taq DNA 94
polymerase (Roche Diagnostics). A 1μL aliquot of the PCR product from the first reaction 95
was then used as a template for the second round of amplification. The second PCR was 96
performed in a total volume of 25 μL and contained 8 mM of each dNTP (Thermo Scientific), 97
10 mM of MgCl2 (ThermoScientific), 7.5 μM of each of the internal primers, 2.5 μL of 10X 98
PCR buffer (Thermo Scientific), and 1.25 U of Taq DNA polymerase (Thermo Scientific). All 99
PCR amplifications were performed under the following conditions: initial denaturation at 100
93°C for 3 min, 35 cycles of denaturation (93°C, 30 s), annealing (Tm=52–56°C, depending 101
on primers, 30 s), extension (72°C, 1 min), and a final extension at 72°C for 5 min. Known 102
positive and negative individuals were used as controls in each PCR assay. All PCR products 103
were visualized with electrophoresis in a 1.5% agarose gel. Positive PCR products were 104
purified and sequenced in both directions (EUROFINS). The chromatograms were manually 105
inspected and cleaned with CHROMAS LITE 106
6 (http://www.technelysium.com.au/chromas_lite.html) and sequence alignments were done 107
using CLUSTALW (Thompson et al., 2003), both implemented in MEGA (Tamura et al., 108
2007). Novel nucleotide sequences have been deposited in the GenBank nucleotide database 109
(Accession numbers: ‘Candidatus Rickettsia africaseptentrioalis’, gltA [pending], 16S rRNA 110
[pending], coxA [pending] and ompB [pending]; ‘Candidatus Rickettsia mauretaniae’, gltA 111
[pending], 16S rRNA [pending], coxA [pending] and ompB [pending]). 112
113
2.3. Molecular phylogenetics 114
The GBLOCKS program (Castresana, 2000) with default parameters was used to remove 115
poorly aligned positions and to obtain unambiguous sequence alignments. All sequence 116
alignments were also checked for putative recombinant regions using the RDP3 computer 117
analysis package (Martin et al., 2010). Given a set of aligned nucleotide sequences, RDP3 can 118
rapidly analyze these with a range of powerful non-parametric recombination detection 119
methods, including the GENECONV (Sawyer, 1999) and RDP (Martin and Rybicki, 2000). 120
Phylogenetic relationships were evaluated between Rickettsia strains using gltA, 16S rRNA, 121
coxA and ompB gene sequences. In addition to the sequences produced in this study, 122
additional Rickettsia sequences, representative of the diversity in the genus and available from 123
GenBank, were also used. The evolutionary models most closely fitting the sequence data 124
were determined using Akaike information criterion with the MEGA program (Tamura et al., 125
2007). Phylogenetic analyses were based on maximum likelihood (ML) analyses. A ML 126
heuristic search, using a starting tree obtained by neighbor-joining, was conducted and clade 127
robustness was further assessed by bootstrap analysis using 1,000 replicates in MEGA 128 (Tamura et al., 2007). 129 130 3. Results 131
3.1. Multilocus typing of Rickettsia 132
7 The diversity of Rickettsia in O. occidentalis, O. erraticus and O. normandi was examined 133
using gltA (589 bp), 16S rRNA (729 bp), coxA (562 bp) and ompB (672 bp) gene sequences. 134
The Rickettsia 16S rRNA, coxA and ompB genes were amplified and sequenced here from all 135
tick DNA templates (n=6), while all the gltA gene sequences were already available in 136
GenBank from Duron et al. (2017). All sequences were easily readable without double peaks, 137
indicating a confident degree of primer specificity for Rickettsia PCR amplifications. All 138
these sequences belong unambiguously to the Rickettsia genus as described below. 139
140
On the basis of DNA sequences, we characterized one to three distinct alleles depending on 141
the Rickettsia gene (Table 2), including three alleles for gltA (98.3–99.66% pairwise 142
nucleotide identity), one for 16S rRNA, two for coxA (99.29% pairwise nucleotide identity) 143
and three for ompB (98.08–99.68% pairwise nucleotide identity). Overall, the allelic variation 144
at the five gene markers led to the identification of three different Rickettsia genotypes (A, B 145
and C hereafter): the A genotype was found in O. erraticus (n=1), the B genotype in O. 146
normandi (n=1), while the C genotype was shared by all O. occidentalis specimens (n=4) 147
(Table 2). None of these three genotypes showed 100% nucleotide identity at the four gene 148
markers with other Rickettsia species and strains available in GenBank, including other 149
Rickettsia spp. previously documented in soft ticks (i.e., R. bellii, R. hoogstraalii, R. 150
wissemanii, R. nicoyana and R. lusitianiae; Table 3). In terms of nucleotide identity, the 151
closest Rickettsia species of the A, B and C Rickettsia genotypes are R. felis, R. asemboensis, 152
R. hoogstraalii, R. senegalensis and R. lusitianiae, which all belong to the transitional 153
Rickettsia group (Table 3). If compared together, the A, B and C genotypes showed a 154
substantial nucleotide divergence at the four gene sequences examined but they had a better 155
pairwise nucleotide identity with each other than with any other Rickettsia species and strains 156
(Table 3). 157
8 3.2. Phylogenetics of Rickettsia
159
Maximum-likelihood (ML) analyses were further used to examine the evolutionary 160
relationships of the A, B and C Rickettsia genotypes of O. occidentalis, O. erraticus and O. 161
normandi with 38 other Rickettsia species, including other known Rickettsia from soft ticks. 162
We observed no sign of recombination in the data set: (i) the comparison between Rickettsia 163
gltA, 16S rRNA, coxA and ompB single gene phylogenies revealed the same phylogenetic 164
branching (Figure 1A–D) and (ii) the analysis of concatenated sequences did not detect 165
significant recombination events between the Rickettsia sequences used in the ML analyses 166
(all P>0.10 for the GENECONV and RDP recombination-detection tests). The single gltA, 167
16S rRNA, coxA and ompB gene phylogenies and concatenated phylogeny consistently 168
showed that the A, B and C Rickettsia genotypes of O. occidentalis, O. erraticus and O. 169
normandi are markedly divergent to known Rickettsia species and strains (Figures 1A–D and 170
2). The A and B Rickettsia genotypes clustered together, suggesting that they belong to the 171
same species, while the C Rickettsia genotype belongs to a distinct, albeit close, species. 172
These two putative species are phylogenetically related to but divergent from some other 173
Rickettsia species belonging to the transitional phylogenetic group. It clustered within a 174
robust monophyletic clade including other Rickettsia species reported from soft ticks, R. 175
hoogstraalii and R. lusitianiae, and Rickettsia reported from fleas, R. felis, R. senegalensis 176
and R. asemboensis (Figures 1A–D and 2). 177
178
4. Discussion
179
While only a few Rickettsia species have been reported from soft ticks (Duh et al., 2010; 180
Duron et al., 2018; Hornok et al., 2019; Milhano et al., 2014; Moreira-Soto et al., 2017; 181
Sánchez-Montes et al., 2016; Tahir et al., 2016; Yan et al., 2019), in this study we identified 182
two novel Rickettsia species in soft tick Ornithodoros species from North Africa. The MLST 183
of four gene fragments fulfills the criteria usually used to designate new Rickettsia species 184
9 (e.g. Anstead and Chilton, 2013; Milhano et al., 2014; Moreira-Soto et al., 2017; Tahir et al., 185
2016; Turebekov et al., 2019): their allelic profiles, showing a substantial magnitude of 186
difference, are unique relative to all recognized and putative species within the Rickettsia 187
genus. On account of its distinct genetic and phylogenetic traits described, we propose the 188
designation ‘Candidatus Rickettsia africaseptentrioalis’ (a'fri.ca sep.ten.tri.o'a.lis, referring to 189
North Africa where the organism was isolated) for the species found in O. erraticus (A 190
Rickettsia genotype) and O. normandi (B Rickettsia genotype), and ‘Candidatus Rickettsia 191
mauretaniae’ (ma.o.re.'ta.njae, referring to Mauretania [a region in the ancient Maghreb 192
during Antiquity] where the organism was isolated) for the species found in O. occidentalis 193
(C Rickettsia genotype). Interestingly, the MLST data set also indicated the presence of at 194
least two clearly distinct genotypes of ‘Candidatus R. africaseptentrioalis’, one present in O. 195
erraticus from Algeria and the other in O. normandi from Tunisia. These localities are more 196
than 350 km apart, suggesting that a greater diversity of ‘Candidatus R. africaseptentrioalis’ 197
genotypes may circulate across North Africa. 198
199
The soft ticks O. occidentalis, O. erraticus and O. normandi all belong to the O. erraticus 200
species complex. While small mammals are the most common hosts of these species, they are 201
also among the most common soft ticks to bite humans (Trape et al., 2013). Two of these 202
ticks, O. occidentalis and O. normandi, are known to be only from North Africa, but O. 203
erraticus is more widespread and is reported from many Mediterranean regions, including the 204
Iberian Peninsula in Europe and the Middle East. These Ornithodoros species commonly 205
carry the relapsing fever agents Borrelia crocidurae and Borrelia hispanica and the African 206
swine fever viruses (Boinas et al., 2011; Trape et al., 2013), but they have never been found to 207
carry a pathogenic Rickettsia. In this context, whether or not ‘Candidatus Rickettsia 208
africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’ are potential human pathogens 209
is a question worthy of interest. These two novel species belong the transitional phylogenetic 210
10 group of Rickettsia and are closely related to R. asemboensis: this Rickettsia species was 211
described in 2013 in fleas and was latter reported in ticks (Troyo et al., 2016). Its pathogenesis 212
in vertebrate hosts is unknown (Jiang et al., 2013). Another close relative is R. felis which is 213
the causative agent of flea-borne spotted fever. This cosmopolitan pathogen, first described as 214
a human pathogen from the United States in 1991, is now considered a common cause of 215
fever in Africa (Brown and Macaluso, 2016). However, at least one R. felis strain, called LSU, 216
is a non-infectious maternally inherited symbiont inducing parthenogenesis in book lice 217
(Behar et al., 2010; Gillespie et al., 2014). This last example clearly shows that not all 218
Rickettsia of the transitional phylogenetic group are pathogens. Because the pathogenicity of 219
‘Candidatus Rickettsia africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’ is still 220
unknown, considering these species as important pathogens might be premature. As pointed 221
out by Labruna and Walker (2014), the current view in rickettsiology has a strong 222
anthropocentric bias and tends to describe all novel Rickettsia species as pathogenic forms. In 223
many arthropods (e.g., ladybirds, spiders and book lice, but also ticks), Rickettsia are non-224
pathogenic and undergo exclusive maternal transmission to offspring, which functions as both 225
mutualist and reproductive manipulator (Bonnet et al., 2017; Perlman et al., 2006; Weinert, 226
2015; Weinert et al., 2009). As a result, the putative pathogenicity of ‘Candidatus Rickettsia 227
africaseptentrioalis’ and ‘Candidatus Rickettsia mauretaniae’ should be the aim of further 228
studies before a definitive decision is reached on this effect. 229
230
Competing interests
231
The authors declare that they have no competing interests. 232
233
Acknowledgments
234
We are grateful to Céline Arnathau, Georges Diatta, Patrick Durand, François Renaud, Jean-235
François Trape and Laurence Vial for help at different stages of this work. We also 236
11 acknowledge useful discussions with members of the French group Tiques et Maladies à 237
Tiques (TMT). Financial support was provided by recurrent funding from the Centre National 238
de la Recherche Scientifique (CNRS) and Institut de Recherche pour le Développement 239 (IRD). 240 241 References 242
Anstead, C.A., Chilton, N.B., 2013. A Novel Rickettsia Species Detected in Vole Ticks 243
(Ixodes angustus) from Western Canada. Appl. Environ. Microbiol. 79, 7583–7589. 244
https://doi.org/10.1128/AEM.02286-13 245
Behar, A., McCormick, L.J., Perlman, S.J., 2010. Rickettsia felis Infection in a Common 246
Household Insect Pest, Liposcelis bostrychophila (Psocoptera: Liposcelidae). Appl. 247
Environ. Microbiol. 76, 2280–2285. https://doi.org/10.1128/AEM.00026-10 248
Boinas, F.S., Wilson, A.J., Hutchings, G.H., Martins, C., Dixon, L.J., 2011. The persistence 249
of African swine fever virus in field-infected Ornithodoros erraticus during the ASF 250
endemic period in Portugal. PLoS One 6. https://doi.org/10.1371/journal.pone.0020383 251
Bonnet, S.I., Binetruy, F., Hernandez, A.M., Duron, O., 2017. The Tick Microbiome: Why 252
Non-pathogenic Microorganisms Matter in Tick Biology and Pathogen Transmission. 253
Front. Cell. Infect. Microbiol. 7. https://doi.org/10.3389/fcimb.2017.00236 254
Brown, L.D., Macaluso, K.R., 2016. Rickettsia felis, an Emerging Flea-Borne Rickettsiosis. 255
Curr. Trop. Med. Reports 3, 27–39. https://doi.org/10.1007/s40475-016-0070-6 256
Castresana, J., 2000. Selection of Conserved Blocks from Multiple Alignments for Their Use 257
in Phylogenetic Analysis. Mol. Biol. Evol. 17, 540–552. 258
https://doi.org/10.1093/oxfordjournals.molbev.a026334 259
Duh, D., Punda-Polic, V., Avsic-Zupanc, T., Bouyer, D., Walker, D.H., Popov, V.L., 260
Jelovsek, M., Gracner, M., Trilar, T., Bradaric, N., Kurtti, T.J., Strus, J., 2010. Rickettsia 261
hoogstraalii sp. nov., isolated from hard- and soft-bodied ticks. Int. J. Syst. Evol. 262
12 Microbiol. 60, 977–984. https://doi.org/10.1099/ijs.0.011049-0
263
Duron, O., Binetruy, F., Noel, V., Cremaschi, J., McCoy, K., Arnathau, C., Plantard, O., 264
Goolsby, J., Perez De Leon, A.A., Heylen, D.J.A., Raoul Van Oosten, A., Gottlieb, Y., 265
Baneth, G., Guglielmone, A.A., Estrada-Pena, A., Opara, M.N., Zenner, L., Vavre, F., 266
Chevillon, C., 2017. Evolutionary changes in symbiont community structure in ticks. 267
Mol. Ecol. 26, 2905–2921. https://doi.org/10.1111/mec.14094 268
Duron, O., Morel, O., Noël, V., Buysse, M., Binetruy, F., Lancelot, R., Loire, E., Ménard, C., 269
Bouchez, O., Vavre, F., Vial, L., 2018. Tick-Bacteria Mutualism Depends on B Vitamin 270
Synthesis Pathways. Curr. Biol. 28, 1–7. https://doi.org/10.1016/j.cub.2018.04.038 271
Gillespie, J.J., Drisco, T.P., Verhoeve, V.I., Utsuki, T., Husseneder, C., Chouljenko, V.N., 272
Azad, A.F., MacAluso, K.R., 2014. Genomic Diversification in Strains of Rickettsia felis 273
Isolated from Different Arthropods. Genome Biol. Evol. 7, 35–56. 274
https://doi.org/10.1093/gbe/evu262 275
Gottlieb, Y., Ghanim, M., Chiel, E., Gerling, D., Portnoy, V., Steinberg, S., Tzuri, G., 276
Horowitz, R.A., Belausov, E., Mozes-daube, N., Kontsedalov, S., Gershon, M., Gal, S., 277
Katzir, N., Zchori-fein, E., 2006. Identification and Localization of a Rickettsia sp. in 278
Bemisia tabaci (Homoptera: Aleyrodidae). Appl. Environ. Microbiol. 72, 3646–3652. 279
https://doi.org/10.1128/AEM.72.5.3646 280
Hornok, S., Szoke, K., Meli, M.L., Sandor, A.D., Gorfol, T., Estok, P., Wang, Y., Tu, V.T., 281
Kovats, D., Boldogh, S.A., Corduneanu, A., Sulyok, K.M., Gyuranecz, M., Kontschan, 282
J., Takacs, N., Halajian, A., Epis, S., Hofmann-Lehmann, R., 2019. Molecular detection 283
of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of 284
the Old and New Worlds. Parasit. Vectors 12, 1–7. https://doi.org/10.1186/s13071-019-285
3303-4 286
Jiang, J., Maina, A.N., Knobel, D.L., Cleaveland, S., Laudisoit, A., Wamburu, K., Ogola, E., 287
Parola, P., Breiman, R.F., Njenga, M.K., Richards, A.L., 2013. Molecular detection of 288
13 Rickettsia felis and Candidatus Rickettsia Asemboensis in Fleas from Human Habitats, 289
Asembo, Kenya . Vector-Borne Zoonotic Dis. 13, 550–558. 290
https://doi.org/10.1089/vbz.2012.1123 291
Kurtti, T.J., Felsheim, R.F., Burkhardt, N.Y., Oliver, J.D., Heu, C.C., Munderloh, U.G., 2015. 292
Rickettsia buchneri sp. nov., a rickettsial endosymbiont of the blacklegged tick Ixodes 293
scapularis. Int. J. Syst. Evol. Microbiol. 65, 965–970. 294
https://doi.org/10.1099/ijs.0.000047 295
Labruna, M.B., 2009. Ecology of Rickettsia in South America, in: Hechemy, K.E., Brouqui, 296
P., Samuel, J.E., Raoult, D.A. (Eds.), Fifth International Conference on Rickettsiae and 297
Rickettsial Diseases. Blackwell Publishing, Marseille, France, pp. 156–165. 298
Labruna, M.B., Walker, D.H., 2014. Rickettsia felis and Changing Paradigms about 299
Pathogenic Rickettsia. Emerg. Infect. Dis. 20, 1768–1769. 300
https://doi.org/10.3201/eid2010.131797 301
Martin, D., Rybicki, E., 2000. RDP: detection of recombination amongst aligned sequences. 302
Bioinformatics 16, 562–563. https://doi.org/10.1093/bioinformatics/16.6.562 303
Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010. RDP3: A 304
flexible and fast computer program for analyzing recombination. Bioinformatics 26, 305
2462–2463. https://doi.org/10.1093/bioinformatics/btq467 306
Milhano, N., Palma, M., Marcili, A., Núncio, M.S., de Carvalho, I.L., De Sousa, R., 2014. 307
Rickettsia lusitaniae sp. nov. isolated from the soft tick Ornithodoros erraticus (Acarina: 308
Argasidae). Comp. Immunol. Microbiol. Infect. Dis. 37, 189–193. 309
https://doi.org/10.1016/j.cimid.2014.01.006 310
Moreira-Soto, R.D., Moreira-Soto, A., Corrales-Aguilar, E., Calderón-Arguedas, Ó., Troyo, 311
A., 2017. ‘Candidatus Rickettsia nicoyana’: A novel Rickettsia species isolated from 312
Ornithodoros knoxjonesi in Costa Rica. Ticks Tick. Borne. Dis. 8, 532–536. 313
https://doi.org/10.1016/j.ttbdis.2017.02.015 314
14 Parola, P., Paddock, C.D., Raoult, D., 2005. Tick-Borne Rickettsioses around the World: 315
Emerging Diseases Challenging Old Concepts. Clin. Microbiol. Rev. 18, 719–756. 316
https://doi.org/10.1128/CMR.18.4.719-756.2005 317
Perlman, S.J., Hunter, M.S., Zchori-Fein, E., 2006. The emerging diversity of Rickettsia. 318
Proc. R. Soc. B 273, 2097–2106. https://doi.org/10.1098/rspb.2006.3541 319
Sánchez-Montes, S., Guzmán-Cornejo, C., Martínez-Nájera, Y., Becker, I., Venzal, J.M., 320
Labruna, M.B., 2016. Rickettsia lusitaniae associated with Ornithodoros yumatensis 321
(Acari: Argasidae) from two caves in Yucatan, Mexico. Ticks Tick. Borne. Dis. 7, 1097– 322
1101. https://doi.org/10.1016/j.ttbdis.2016.09.003 323
Sawyer, S.A., 1999. GENECONV: A computer package for the statistical detection of gene 324
conversion. Distrib. by author, Dep. Math. Washingt. Univ. St. Louis. Available at http:// 325
www.math.wustl.edu/~sawy. 326
Tahir, D., Socolovschi, C., Marié, J. Lou, Ganay, G., Berenger, J.M., Bompar, J.M., Blanchet, 327
D., Cheuret, M., Mediannikov, O., Raoult, D., Davoust, B., Parola, P., 2016. New 328
Rickettsia species in soft ticks Ornithodoros hasei collected from bats in French Guiana. 329
Ticks Tick. Borne. Dis. 7, 1089–1096. https://doi.org/10.1016/j.ttbdis.2016.09.004 330
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics 331
Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596–1599. 332
https://doi.org/10.1093/molbev/msm092 333
Thompson, J.D., Gibson, T.J., Higgins, D.G., 2003. Multiple Sequence Alignment Using 334
ClustalW and ClustalX. Curr. Protoc. Bioinforma. 2.3.1-2.3.22. 335
https://doi.org/10.1002/0471250953.bi0203s00 336
Trape, J.F., Diatta, G., Arnathau, C., Bitam, I., Sarih, M., Belghyti, D., Bouattour, A., 337
Elguero, E., Vial, L., Mané, Y., Baldé, C., Pugnolle, F., Chauvancy, G., Mahé, G., 338
Granjon, L., Duplantier, J.M., Durand, P., Renaud, F., 2013. The Epidemiology and 339
Geographic Distribution of Relapsing Fever Borreliosis in West and North Africa, with a 340
15 Review of the Ornithodoros erraticus Complex (Acari: Ixodida). PLoS One 8.
341
https://doi.org/10.1371/journal.pone.0078473 342
Troyo, A., Moreira-Soto, R.D., Calderon-Arguedas, Ó., Mata-Somarribas, C., Ortiz-Tello, J., 343
Barbieri, A.R.M., Avendaño, A., Vargas-Castro, L.E., Labruna, M.B., Hun, L., Taylor, 344
L., 2016. Detection of rickettsiae in fleas and ticks from areas of Costa Rica with history 345
of spotted fever group rickettsioses. Ticks Tick. Borne. Dis. 7, 1128–1134. 346
https://doi.org/10.1016/j.ttbdis.2016.08.009 347
Turebekov, N., Abdiyeva, K., Yegemberdiyeva, R., Dmitrovsky, A., Yeraliyeva, L., 348
Shapiyeva, Z., Amirbekov, A., Oradova, A., Kachiyeva, Z., Ziyadina, L., Hoelscher, M., 349
Froeschl, G., Dobler, G., Zinner, J., Frey, S., Essbauer, S., 2019. Prevalence of Rickettsia 350
species in ticks including identification of unknown species in two regions in 351
Kazakhstan. Parasites and Vectors 12, 1–16. https://doi.org/10.1186/s13071-019-3440-9 352
Weinert, L.A., 2015. The diversity and phylogeny of Rickettsia, in: Morand, S., Krasnov, 353
B.R., Littlewood, D.T.J. (Eds.), Parasite Diversity and Diversification, Evolutionary 354
Ecology Meets Phylogenetics. University Printing House Cambridge, pp. 150-. 355
Weinert, L.A., Araujo-Jnr, E. V., Ahmed, M.Z., Welch, J.J., 2015. The incidence of bacterial 356
endosymbionts in terrestrial arthropods. Proc. R. Soc. B 282. 357
https://doi.org/10.1098/rspb.2015.0249 358
Weinert, L.A., Werren, J.H., Aebi, A., Stone, G.N., Jiggins, F.M., 2009. Evolution and 359
diversity of Rickettsia bacteria. BMC Biol. 7, 1–15. https://doi.org/10.1186/1741-7007-360
7-6 361
Yan, P., Qiu, Z., Zhang, T., Li, Y., Wang, W., Li, M., Yu, Z., Liu, J., 2019. Microbial 362
diversity in the tick Argas japonicus (Acari: Argasidae) with a focus on Rickettsia 363
pathogens. Med. Vet. Entomol. 327–335. https://doi.org/10.1111/mve.12373 364
16
Table 1. Genes and primers used for Rickettsia sequencing.
366
Gene Hypothetical product Primers (5'-3') Tm Fragment size Reference
16S rRNA Small ribosomal R16SF1 CGTGGGAATCTGCCCATCAG 55°C Semi-nested PCR assay: This study
unit R16SF2 CGCTGATGGATGAGCCCGCGTC 1st round PCR: R16SF1/R16SR1: 854bp
R16SR1 GGTGGTYGCGGATCGCAGAG 2nd round PCR: R16SF2/R16SR1: 772bp
gltA Citrate synthase RgltAF1 CCTATGGCTATTATGCTTGCGGC 56°C Semi-nested PCR assay: Duron et al. 2017
RgltAF2 GGTTCTCTTTCKGCATTTTATCC 1st round PCR: RgltAF1/RgltAR1: 664bp
RgltAR1 CTTGAAGCTATCGCTCTTAAAGATG 2nd round PCR: RgltAF2/RgltAR1: 637bp
ompB Outer membrane RompBF1 GGCTGGACCTGAAGCTGGAGC 52°C Nested PCR assay: This study
protein RompBF2 GTTGCTGCAGGTGACGAAGCTG 1st round PCR: RompBF1/RompBR2: 834bp
RompBR1 GTCCATCTAACTGAGACTGAG 2nd round PCR: RompBF2:RompBR1: 715bp
RompBR2 GCATCAGGTCTTATGCTTGCAC
coxA Cytochrome C RcoxAF2 CCYGATATGGCATTTCCACGCC 55°C Semi-nested PCR assay: This study
oxydase subunit I RcoxAR1 ATCGTATGGGCTCACCATATGT 1st round PCR: RcoxAF2/RcoxAR2: 886bp
RcoxAR2 AAGCACCGAGCGACATCGTA 2nd round PCR: RcoxAF2/RcoxAR1: 607bp
17
Table 2. Sequence profiles of the four genes (16S rRNA, gltA, coxA and ompB) in the three Rickettsia genotypes (A–B: ‘Candidatus Rickettsia
368
africaseptentrioalis’; C: ‘Candidatus Rickettsia mauretaniae’) identified in this study. Letters a–c represent the different alleles at each gene locus. n, 369
number of specimens by each Rickettsia genotype. 370
Rickettsia genes
Rickettsia host species (n) 16S rRNA gltA ompB coxA Rickettsia haplotypes
Ornithodoros erraticus (n=1) a a a a A
Ornithodoros normandi (n=1) a b b a B
Ornithodoros occidentalis (n=4) a c c c C
18
Table 3. Sequence similarity of the 16S rRNA, gltA, coxA and ompB gene sequences of the three Rickettsia genotypes (A–B: ‘Candidatus Rickettsia
372
africaseptentrioalis’; C: ‘Candidatus Rickettsia mauretaniae’) detected in O. erraticus, O. normandi and Ornithodoros occidentalis to those of closely 373
related Rickettsia species or Rickettsia species of other soft tick species available in GenBank. 374
Gene Rickettsia (Genbank accession no.) % Sequence similarity
Rickettsia of O. erraticus Rickettsia of O. normandi Rickettsia of O. occidentalis
16s rRNA R. lusitaniae _ _ _ R. asemboensis (JWSW00000000) 99.73 (727 of 729bp) 99.73 (727 of 729bp) 99.73 (727 of 729bp) R. felis (CP000053) 99.86 (728 of 729bp) 99.86 (728 of 729bp) 99.86 (728 of 729bp) R. hoogstraalii (CCXM00000000) 99.86 (728 of 729bp) 99.86 (728 of 729bp) 99.86 (728 of 729bp) R. wissemanii (LT558851) 99.45 (725 of 729bp) 99.45 (725 of 729bp) 99.45 (725 of 729bp) R. nicoyana (KX228147) 99.59 (726 of 729bp) 99.59 (726 of 729bp) 99.59 (726 of 729bp) R. bellii (CP000849) 99.04 (722 of 729bp) 99.04 (722 of 729bp) 99.04 (722 of 729bp) gltA R. lusitaniae (JQ771933) 97.96 (577 of 589bp) 97.62 (575 of 589bp) 97.28 (573 of 589bp) R. asemboensis (JWSW00000000) 97.28 (573 of 589bp) 96.94 (571 of 589bp) 96.60 (569 of 589bp) R. felis (CP000053) 96.43 (568 of 589bp) 96.10 (566 of 589bp) 95.76 (564 of 589bp) R. hoogstraalii (CCXM00000000) 96.77 (570 of 589bp) 96.43 (568 of 589bp) 96.10 (566 of 589bp) R. wissemanii (LT558852) 92.36 (544 of 589bp) 92.02 (542 of 589bp) 92.02 (542 of 589bp) R. nicoyana (KX228143) 92.36 (544 of 589bp) 92.02 (542 of 589bp) 92.02 (542 of 589bp) R. bellii (CP000849) 85.91 (506 of 589bp) 85.74 (505 of 589bp) 85.57 (504 of 589bp) ompB R. lusitaniae _ _ _ R. asemboensis (JWSW00000000) 98.07 (659 of 672bp) 97.92 (658 of 672bp) 97.32 (654 of 672pb) R. felis (CP000053) 98.07 (659 of 672bp) 97.92 (658 of 672bp) 97.17 (653 of 672pb) R. hoogstraalii (CCXM00000000) 98.51 (662 of 672bp) 98.36 (661 of 672bp) 97.62 (656 of 672pb) R. wissemanii (LT558854) 97.44 (304 of 312bp) 97.12 (303 of 312bp) 97.12 (303 of 312pb) R. nicoyana _ _ _
19 R. bellii (CP000849) 78.87 (530 of 672bp) 78.72 (529 of 672bp) 78.57 (528 of 672pb) coxA R. lusitaniae _ _ _ R. asemboensis (JWSW00000000) 96.62 (543 of 562pb) 96.62 (543 of 562pb) 95.91 (539 of 562pb) R. felis (CP000053) 95.73 (538 of 562pb) 95.73 (538 of 562pb) 95.02 (534 of 562pb) R. hoogstraalii (CCXM00000000) 95.91 (539 of 562pb) 95.91 (539 of 562pb) 95.19 (535 of 562pb) R. wissemanii _ _ _ R. nicoyana _ _ _ R. bellii (CP000849) 86.83 (488 of 562pb) 86.83 (488 of 562pb) 86.83 (488 of 562pb) 375
20
Figure legends
376
Fig. 1. Phylogeny of Rickettsia constructed using maximum-likelihood (ML) estimations
377
based on (A) gltA gene sequences (589 unambiguously aligned nucleotide sites; best-fit 378
approximation for the evolutionary model: GTR + G+I); (B) 16S rRNA sequences (729 379
unambiguously aligned nucleotide sites; best-fit approximation for the evolutionary model: 380
HKY+G+I); (C) coxA gene sequences (562 unambiguously aligned nucleotide sites; best-fit 381
approximation for the evolutionary model: GTR + G+I); (D) ompB gene sequences (672 382
unambiguously aligned nucleotide sites; best-fit approximation for the evolutionary model: 383
GTR + G). Circles indicate Rickettsia species found in soft ticks (black circles: sequences 384
from Rickettsia characterized in this study from Ornithodoros occidentalis, O. erraticus and 385
O. normandi; white circles: sequences from Rickettsia characterized from other tick species 386
and available in GenBank). Sequences from representative Rickettsia groups, species and 387
strains available in GenBank were also added to the analysis. The grey boxes delineate the 388
different Rickettsia groups (their names are indicated in upper case). Bacterial name, host 389
species and GenBank accession numbers are shown on the tree. Branch numbers indicate 390
percentage bootstrap support for major branches (1000 replicates; only bootstrap values >70% 391
are shown). The scale bar is in units of substitution/site. 392
393
Fig. 2. Phylogeny of Rickettsia constructed using maximum-likelihood (ML) estimations
394
based on concatenated gltA, 16S rRNA, coxA and ompB sequences (2552 unambiguously 395
aligned nucleotide sites; best-fit approximation for the evolutionary model: GTR + G+I). 396
Circles indicate Rickettsia species found in soft ticks (black circles: sequences from Rickettsia 397
characterized in this study from Ornithodoros occidentalis, O. erraticus and O. normandi; 398
white circles: sequences from Rickettsia characterized from other tick species and available in 399
GenBank). Sequences from representative Rickettsia groups, species and strains available in 400
GenBank were also added to the analysis. The grey boxes delineate the different Rickettsia 401
21 groups (their names are indicated in upper case). Bacterial name, host species and GenBank 402
accession numbers are shown on the tree. Branch numbers indicate percentage bootstrap 403
support for major branches (1000 replicates; only bootstrap values >70% are shown). The 404
scale bar is in units of substitution/site. 405
