• Aucun résultat trouvé

Metabarcoding of Bacterial Pathogens in a Rodent Pest: Which Organ?

N/A
N/A
Protected

Academic year: 2021

Partager "Metabarcoding of Bacterial Pathogens in a Rodent Pest: Which Organ?"

Copied!
2
0
0

Texte intégral

(1)

HAL Id: hal-01870929

https://hal.archives-ouvertes.fr/hal-01870929

Submitted on 10 Sep 2018

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Metabarcoding of Bacterial Pathogens in a Rodent Pest:

Which Organ?

P. Villette, Eve Afonso, G Couval, A Levret, M. Galan, C. Tatard, J.-F Cosson, P. Giraudoux, J.-F Giraudoux

To cite this version:

P. Villette, Eve Afonso, G Couval, A Levret, M. Galan, et al.. Metabarcoding of Bacterial Pathogens in a Rodent Pest: Which Organ?. SMBE 2016: Society for Molecular Biology and Evolution Annual Meeting, Jul 2016, Gold Coast, Queensland, Australia. �hal-01870929�

(2)

Different organs host different bacteria, and bacteria are not concentrated in a single organ

Conclusion: We should use all five organs when we are looking for

bacteria in water voles

Water voles ( Arvicola terrestris ) are pests in Franche-Comte

But...

These patterns of different bacteria in different organs

appear random*

*PERMANOVA with Jaccard dissimilarity indices, pseudo-F4,51 = 1.34, p=0.120

€ €

When they are abundant, they can cost a single farmer thousands of euros in

damage per year

Water voles can carry tapeworms that are dangerous to humans

With which organ should we look for bacteria?

We can use DNA sequencing technology to search for bacteria, but we need to know which organs to look in.

We know little about the bacteria hosted by this

rodent; bacteria may drive changes in vole abundance, and may also pose a risk to human health

Metabarcoding of Bacterial Pathogens in a

Rodent Pest: Which Organ?

P. Villette1, E. Afonso1, G. Couval2, A. Levret2, M. Galan3, C. Tatard3, J.-F. Cosson4, P. Giraudoux1,5

1 Laboratoire Chrono-environnement, UMR 6249 Universite de Bourgogne Franche-Comte, Besancon, France 2 FREDON Franche-Comte, Ecole Valentin, France

3 INRA, CBGP, Montferrier sur Lez, France 4 INRA, Bipar, Maisons-Alfort, France 5 Institut Universitaire de France

Year

Water vole abundance varies from year to year, and from

place to place *Adapted from Berthier et al (2014)

50 km

Besancon France

Franche-Comte

AbundanceAbundanceAbundance

1990 1991 1992 1993 1994 1995

The water vole, Arvicola terrestris

15 cm

Berthier, K., Piry, S., Cosson, J.-F., Giraudoux, P., Foltete, J.-C., Defaut, R., Truchetet, D., Lambin, X.

(2014) Dispersal, landscape, and travelling waves in cyclic vole poulations. Ecology Letters, 17:53-64

Heart Lungs

Liver

Kidneys

ATTCGATCGTGCTAGCTGACGTCAGTTACGT GCTATGCATGCATGGTCATGCATGCAGTATC GATCGTAGCTAGAGGATTAGGATATGCGCG GTCAGTCATGTGATTTATTTAGCGAGCGCCC CAGTGCTATATATGCGCGATCTTAGCTAGCG ATCTGATGTGCTGATGATACTGACTGTGACT CAGTACTGACTGAAATCATGCGCCGCACACA CAATATATTTATGCTTGTGCACGTGTGTTTGT CGCGGGATTTTGAGCGAGCGCCGCGCGATTA

*High-throughput DNA sequencing of the V4 region of the 16s rRNA bacterial gene using the Illumina MiSeq platform. Sequences were grouped into Operation

Taxonomic Units (OTUs) using a 97% similarity threshold, and taxonomy was assigned using the Silva SSU Reference database.

We collected 13 water voles from Franche-Comte, and extracted and sequenced bacterial DNA from their hearts, lungs, livers, spleens, and kidneys*

We found 25 potentially pathogenic bacteria in our voles

Bartonella

Bacterial parasites that are transmitted by ticks and fleas. The causative agent of cat-scratch disease is a member of this genus

Acinetobacter

Common soil bacteria that can cause infections in

already-sick animals

Mycoplasma

A diverse group, bacteria in this genus can infect mammals, birds, reptiles, fish, insects, and plants

Other bacteria we found:

Avibacterium Pasteurellaceae Helicobacter Aerococcus

Chryseobacterium Cornyebacterium Leptospira

Peptococcus Sphingomonas Streptococcus Ureaplasma These are bacteria that we know can cause disease in animals, and may be

causing disease in our voles. The 5 most prevalent bacteria we found:

Treponema

The causative agents of

yaws and human and rabbit syphilis are members of

this genus

If we pool all organs within an animal, we find an average of 5.4 bacterial species per animal*

*5.4 ± 0.7 (mean ± standard error), which is 2.9 ± 0.9 species (bootstrapped mean and 95% confidence interval) greater than the mean bacterial richness of the heart, the organ with the highest bacterial richness.

We found different bacteria in different organs

All five organs had similar bacterial species richness *

*Mean bacterial species richness ranged from 1.5-2.5 species/organ, and did not differ significantly between organs (generalized linear mixed-effects model for average OTU richness within organs, with animal as a random effect. The model was fit using maximum likelihood, a Poisson distribution, and log-link function). Error bars are standard error.

Bacterial Species Richness

1 2 3

And...

2 3 4 5 6

1

All 5 organs are necessary for detecting all the bacteria present in the animal*

*Bootstrapped mean bacterial richness as organs are included in the richness calculation for each animal. Error bars are bootstrapped 95% confidence intervals (999 iterations for means and confidence intervals). Increasing mean richness with increasing nmber of organs indicates that organs differ in the bacterial they host, and that bacteria are not

concentrated in one or two organs

Bacterial Species Richness

In addition, all 5 organs are necessary to detect host-population-level differences in bacterial assemblages. The animals sampled here are from two different populations; we found that organ bacterial richness does not vary with location (generalized linear mixed-effects model for

average OTU richness within organs, with animal and location as random effects, fit using maximum likelihood, a Poisson distribution, and log-link function), but differences in pooled, liver, and lung bacterial assemblages map to host populations (ordination and PERMANOVA analysis of Jaccard dissimilarities). Livers and lungs are prone to having no detectable bacteria, making them poor candidates for studying host-population level bacterial assemblages, thus pooling organs within animals is the "best" choice.

Spleen

Références

Documents relatifs

http://www.discoverlife.org/mp/20q?search=Apoidea Creators: Kerry Schiel and Geoffrey Caruso University of Luxembourg Institute of Geography and Spatial Planning Classification

Y sont cités notamment le fait d’interdire toute « discrimination fondée sur le handicap dans tout ce qui a trait à l’emploi sous toutes ses formes, notamment les conditions

Terminologie concernant les personnes ayant vécu ou vivant une expérience concrète de consommation de substances SUJET ÉVITEZ CES TERMES STIGMATISANTS ÉQUIVALENTS TERMINOLOGIQUES

Distribution profile of trapped invertebrate families accord- ing to their preferential presence in the field margin strip or the adja- cent field crop on both shaded and unshaded

In order to determine whether the lower normalized flux rates in the heated chambers could be caused by differences in leaf morphology, we verified whether the specific leaf

We also found that the type of competency affects sto- rytelling: questions about organizing competencies elicited fewer stories than those about the other competencies. The way

Je fus le premier, celui qui aura la lourde charge d’écrire l’histoire de l’humanité et te la transmettre dans sa vérité la plus pure, toi, le Créateur tu es parti pour

C’est pour cela qu’en interrogeant ce Dieu, que l’homme croit être muet et inexistant, sur ces abominations qui ruinent la terre, on a obtenu comme Réponse divine de Sa part ceci