• Aucun résultat trouvé

Table S1. Sequences of primer pairs used for PCR analysis. Gene Id

N/A
N/A
Info
Télécharger
Protected

Academic year: 2021

Partager "Table S1. Sequences of primer pairs used for PCR analysis. Gene Id"

Copied!
1
0
0

Chargement.... (Voir le texte intégral maintenant)

Texte intégral

(1)

Table S1. Sequences of primer pairs used for PCR analysis.

Gene Id

Forward sequence (5’–3’) Reverse sequence (5’–3’)

Amplicon

length

Intron

spanning

GAPDH-std caagttccatggcacagtcaagg aaagtggtcgttgagggcaatgc 760 yes LCN2 accaccacctacgagctgaagg ctgaagaacacgatggcaaactgg 210 yes GAPDH aagtggatattgtcgccatcaat aacttgccatgggtggaatc 88 yes COL1A2-std ctaccactgcaagaacagcattgc ccacaacaggtgtaagagtgctg 547 no COL1A2 gtcactctgcaaggctccaatgat ccaccgatgtccaaaagtgcaatg 185 yes COL3A1 ttgtgcaaaaggggacctggtt gacgcatatttggcatggttctgg 152 yes PPP3CB aggatcggaccatagcaagtcaca agcttttgatagcctgcctcttgc 166 yes GPC4 acgtgtccaaaggcttcgacaa ctgctcgctgaccacacttatgaa 161 yes VCAN gcgctgatccctaaaatggcaaac ggagcacagcaatcccaaatgact 148 no CCL5 ctttcgggtgacaaagacgact accttctgcactcctgcatct 159 yes

DCN aggctagctgcatcaactttggtg agaagctgtcctacatccgcattg 124 yes

CD74 gccaaacctgtgagcaagattcg tcctgtgtcgtgttcccgtactt 119 yes DOCK1 agctgcaccatcagcaaagact ttggtgttggaacgccacttca 110 yes FUCA1 gaccacaaagcatcacgaaggcta ctctggcattgttttcgcactgac 241 yes MTRF1L ccactggctcgcttagtatcgatt atccacaccagcaccatgacagta 104 yes NHLRC2 tcacctgttgcctgatcttcatgc aggaaacttccagctcttgcca 200 yes PTGDR atgcgcaacctctacacgatg caggtctaaacgctccaacggtaa 209 yes LTA4H tgtcaggacactccttccgtgaaa agatgcttctccatcacgaatggc 102 yes EDNRA tgagaattgccctcagtgaacacc atgaagagggaaccagcaaagagc 101 yes CCBP2 tacctggagatcgtccatgctcaa aatggtcccatgccctccaaaatc 189 no IGF1 gtgtgtggagacaggggcttttat acttccttctgagccttgggcata 215 yes ACTG1 atcgtgcgtgacatcaaggagaag gtgttagcatacaggtccttgcga 269 yes

VIM ggcgaagcaggagtcaaatgagta aggtcttggtattcccgaaggtga 225 yes

TRPC4AP atgtccttcctcttccgcctcatt tgttgagcaggaagccaggatact 187 yes ARHGAP25 ccctgtggccagattcaaaaggat cccctggaaaacacagcataccat 289 no

UBB tagcagtttcttcgttgtccgt tgtaatcggaaagagtgcgg 211 yes

GUSB gctcatctggaactttgctgatttt ctgacgagtgaagatcccctttt 85 yes

B2M tcgggctactctccctgactg cggcaactatactcatccacacca 271 yes

PPIA tgctggacccaacacaaatggttc gtccacagtcagcaatggtgatct 182 yes RPLP0 gctgatgggcaagaacaccatgat ggtaaacacaaagcccacattgcc 115 yes RPS9 tcaaattcaccctggccaagatcc gcgcctctccaagaaatcctctat 191 yes

Références

Télécharger maintenant ( PDF - 1 Page - 249.62 KB )

Documents relatifs

Saying yes

So saying yes allowed me to “ride the wave” and become deeply involved in confronting the challenges, con- tributing to the solutions, and experiencing the frustrations and

Is the treatment of obesity futile?: YES

• Even though we should continue to encourage individual patients to lose weight, clinical experience teaches us that the long-term success of non-surgical treatment of obesity is

Should older family physicians retire?: YES

In Quebec, for example, some 30 family physicians older than 80 continue to practise and 1 physi- cian is older than 95.. These numbers are somewhat puzzling and they

Should family physicians be empathetic?: YES

Let’s go back to the definition provided by Hojat et al, 1 which states that the cognitive aspect of empathy refers to a care provider’s ability to understand an experience

“No” supports “Yes”

The more appropriate argument would have been for Dr Richer to express concern for a physician- patient who might be self-prescribing strong pain med- ication; I

Rebuttal: Should newborns be circumcised?: YES

1-4   These  include  low- ering  the  risks  of  human  papillomavirus,  penile  cancer,  cervical  cancer  in  female  sexual  partners, 

Should newborns be circumcised?: YES

Most excitement and public awareness has been engen-

Attention deficit hyperactivity disorder: yes, really.

A s a family physician who treats many children and adults with attention deficit hyperactivity disor- der (ADHD), I was glad to see the August 2006 issue of Canadian