• Aucun résultat trouvé

Table S1. Sequences of primer pairs used for PCR analysis. Gene Id

N/A
N/A
Protected

Academic year: 2021

Partager "Table S1. Sequences of primer pairs used for PCR analysis. Gene Id"

Copied!
1
0
0

Texte intégral

(1)

Table S1. Sequences of primer pairs used for PCR analysis.

Gene Id

Forward sequence (5’–3’) Reverse sequence (5’–3’)

Amplicon

length

Intron

spanning

GAPDH-std caagttccatggcacagtcaagg aaagtggtcgttgagggcaatgc 760 yes LCN2 accaccacctacgagctgaagg ctgaagaacacgatggcaaactgg 210 yes GAPDH aagtggatattgtcgccatcaat aacttgccatgggtggaatc 88 yes COL1A2-std ctaccactgcaagaacagcattgc ccacaacaggtgtaagagtgctg 547 no COL1A2 gtcactctgcaaggctccaatgat ccaccgatgtccaaaagtgcaatg 185 yes COL3A1 ttgtgcaaaaggggacctggtt gacgcatatttggcatggttctgg 152 yes PPP3CB aggatcggaccatagcaagtcaca agcttttgatagcctgcctcttgc 166 yes GPC4 acgtgtccaaaggcttcgacaa ctgctcgctgaccacacttatgaa 161 yes VCAN gcgctgatccctaaaatggcaaac ggagcacagcaatcccaaatgact 148 no CCL5 ctttcgggtgacaaagacgact accttctgcactcctgcatct 159 yes

DCN aggctagctgcatcaactttggtg agaagctgtcctacatccgcattg 124 yes

CD74 gccaaacctgtgagcaagattcg tcctgtgtcgtgttcccgtactt 119 yes DOCK1 agctgcaccatcagcaaagact ttggtgttggaacgccacttca 110 yes FUCA1 gaccacaaagcatcacgaaggcta ctctggcattgttttcgcactgac 241 yes MTRF1L ccactggctcgcttagtatcgatt atccacaccagcaccatgacagta 104 yes NHLRC2 tcacctgttgcctgatcttcatgc aggaaacttccagctcttgcca 200 yes PTGDR atgcgcaacctctacacgatg caggtctaaacgctccaacggtaa 209 yes LTA4H tgtcaggacactccttccgtgaaa agatgcttctccatcacgaatggc 102 yes EDNRA tgagaattgccctcagtgaacacc atgaagagggaaccagcaaagagc 101 yes CCBP2 tacctggagatcgtccatgctcaa aatggtcccatgccctccaaaatc 189 no IGF1 gtgtgtggagacaggggcttttat acttccttctgagccttgggcata 215 yes ACTG1 atcgtgcgtgacatcaaggagaag gtgttagcatacaggtccttgcga 269 yes

VIM ggcgaagcaggagtcaaatgagta aggtcttggtattcccgaaggtga 225 yes

TRPC4AP atgtccttcctcttccgcctcatt tgttgagcaggaagccaggatact 187 yes ARHGAP25 ccctgtggccagattcaaaaggat cccctggaaaacacagcataccat 289 no

UBB tagcagtttcttcgttgtccgt tgtaatcggaaagagtgcgg 211 yes

GUSB gctcatctggaactttgctgatttt ctgacgagtgaagatcccctttt 85 yes

B2M tcgggctactctccctgactg cggcaactatactcatccacacca 271 yes

PPIA tgctggacccaacacaaatggttc gtccacagtcagcaatggtgatct 182 yes RPLP0 gctgatgggcaagaacaccatgat ggtaaacacaaagcccacattgcc 115 yes RPS9 tcaaattcaccctggccaagatcc gcgcctctccaagaaatcctctat 191 yes

Références

Documents relatifs

In this study, expression levels as well as stability of candidate reference genes were measured in chicory root cell cultures submitted to different conditions and also in

Normalized expression levels and ratios revealed by comparative transcriptome analysis (RNA-seq) of the Rom R clone vs HG001 (Excel file).

The effects of coarse ground corn, whole sorghum, and a prebiotic on growth performance, nutrient digestibility, and cecal microbial populations in broilers fed diets with and

The Generation Challenge Programme's Global Composite Germplasm Collection of 3372 wild and cultivated sorghums includes 280 elite breeding lines and improved cultivars, 250

In this work, using a portion of the Phum_PHUM540560 gene from the body louse, we aimed to develop a multiplex real-time polymerase chain reaction (PCR) assay to differentiate

Bisulfite pyrosequencing primers and PCR conditions for human sperm germline differentially methylated regions (DMRs).. (Forward primer has no C, reverse primer has no G

Each dimere distribution was then tested and sequences were suppressed until an acceptable chi-square value... MOTHURhttp://www.mothur.org Alignment Silvabase Distancematrix

Assuming that the differences in tree topology are explained by the most parsimonious route, we predict only 2 independent inter- subgenus recombination events resulting in 10 of