Article
Reference
Prolonged islet allograft survival in diabetic NOD mice by targeting CD45RB and CD154
MOLANO, R Damaris, et al.
Abstract
Clinical islet transplantation is a successful procedure that can improve the quality of life in recipients with diabetes. A drawback of the procedure is the need for chronic administration of immunosuppressive drugs that, among other side effects, are potentially diabetogenic.
Definition of immunosuppressive protocols that utilize nondiabetogenic compounds could further improve islet transplantation outcome. We used the NOD mouse to assess the effect of targeting the T-lymphocyte surface receptors CD45RB and CD154 in preventing loss of allogeneic islet grafts as a result of recurrence of autoimmunity and allorejection.
Administration of the two antibodies led to significantly prolonged allograft survival, with a percentage of grafts surviving long-term. The therapeutic efficacy of the treatment was paralleled by a shift in CD45RB isoform expression on T-lymphocytes, increased in vitro responsiveness to interleukin-7, and increased in vitro gamma-interferon production after anti-CD3 antibody stimulation. Furthermore, graft infiltration by CD8+ T-cells was remarkably reduced. Recipient mice bearing functioning allografts [...]
MOLANO, R Damaris, et al . Prolonged islet allograft survival in diabetic NOD mice by targeting CD45RB and CD154. Diabetes , 2003, vol. 52, no. 4, p. 957-64
DOI : 10.2337/diabetes.52.4.957 PMID : 12663467
Available at:
http://archive-ouverte.unige.ch/unige:45343
Disclaimer: layout of this document may differ from the published version.
Prolonged Islet Allograft Survival in Diabetic NOD Mice by Targeting CD45RB and CD154
R. Damaris Molano,1Antonello Pileggi,1Thierry Berney,1Raffaella Poggioli,1Elsie Zahr,1 Robert Oliver,1Camillo Ricordi,1David M. Rothstein,2Giacomo P. Basadonna,2
and Luca Inverardi1
Clinical islet transplantation is a successful procedure that can improve the quality of life in recipients with diabetes. A drawback of the procedure is the need for chronic administration of immunosuppressive drugs that, among other side effects, are potentially diabeto- genic. Definition of immunosuppressive protocols that utilize nondiabetogenic compounds could further im- prove islet transplantation outcome. We used the NOD mouse to assess the effect of targeting the T-lymphocyte surface receptors CD45RB and CD154 in preventing loss of allogeneic islet grafts as a result of recurrence of autoimmunity and allorejection. Administration of the two antibodies led to significantly prolonged allograft survival, with a percentage of grafts surviving long- term. The therapeutic efficacy of the treatment was paralleled by a shift in CD45RB isoform expression on T-lymphocytes, increased in vitro responsiveness to interleukin-7, and increased in vitro ␥-interferon pro- duction after anti-CD3 antibody stimulation. Further- more, graft infiltration by CD8ⴙT-cells was remarkably reduced. Recipient mice bearing functioning allografts were otherwise immunocompetent, as assessed in vivo and in vitro by numerous tests, including intragraft cytokine production, responsiveness to polyclonal stim- ulation and alloantigens, and analysis of cell subset phenotype. These data show that nondiabetogenic reg- imens of immunomodulation can lead to prolonged islet allograft survival in the challenging NOD mouse model.
Diabetes52:957–964, 2003
R
ecent clinical trials demonstrated that islet transplantation can result in remarkable im- provement in the quality of life of patients with type 1 diabetes by maintaining tight glucose metabolic control in the absence of hypoglycemic epi- sodes (1– 4). However, the need for chronic immuno- suppression with its side effects still limits the use of this procedure to a small cohort of patients with brittle diabe- tes and severe hypoglycemic episodes, where the risksassociated with transplantation and chronic immuno- suppression are justified. Furthermore, currently used immunosuppressive agents have intrinsic diabetogenicity, probably contributing to the observed need for more than one donor organ to achieve insulin independence (5).
Immunomodulatory compounds that allow for pro- longed graft survival in the absence of diabetogenic effects could represent a valuable alternative for the treatment of transplant recipients. To this aim, blockade of signal 1 or 2 of T-cell activation by the use of biological modifiers such as monoclonal antibodies (mAb) and soluble recep- tor ligands has proved effective in preventing or delaying graft rejection as well as autoimmune diseases (6 –21), in the absence of -cell toxicity.
Modulation of signal 1 by administration of anti-CD45RB mAb has shown efficacy in preventing kidney (6), pancreas (7), and islet allograft rejection in murine models (8 –11).
CD45 is a family of protein phosphatases critically in- volved in T-cell receptor–mediated signal transduction (signal 1).
Blockade of signal 2 by selectively targeting co-stimula- tory molecules has also yielded promising results in mod- ulating immune responses and has provided a precious tool to explore the immunological mechanisms underlying transplant rejection and autoimmunity (12). Treatment with anti-CD154 mAb induced long-term allograft accep- tance in several transplantation models (13–16) and effi- ciently prevented autoimmune diseases (17,18), including diabetes (19 –21). CD154 is a tumor necrosis factor recep- tor family member involved (via binding to CD40) in T-cell co-stimulation (signal 2) after antigen recognition.
We have previously reported that simultaneous admin- istration of mAb targeting CD45RB and CD154 protected islet allografts in mice and allowed for the induction of tolerance in a large proportion of recipients in a nonauto- immune background (21). In addition, monotherapy with anti-CD154 mAb significantly prolonged survival of synge- neic and allogeneic islet transplants in spontaneously diabetic NOD mice (21).
NOD mice spontaneously develop autoimmune diabe- tes, arguably representing the best available model for the study of allogeneic islet transplantation in type 1 diabetes.
In NOD mice with already established autoimmune diabe- tes, few treatments lead to prolonged islet allograft sur- vival, and even fewer lead to indefinite acceptance of the graft (22,23). Therapeutic approaches that result in long- term islet graft survival and even immunological tolerance
From the1Cell Transplant Center, Diabetes Research Institute, University of Miami School of Medicine, Miami, Florida; and the2Department of Transplant Surgery, Yale Medical School, New Haven, Connecticut.
Address correspondence and reprint requests to Luca Inverardi, Diabetes Research Institute, University of Miami School of Medicine, 1450 NW 10th Avenue (R-134), Miami, FL 33136. E-mail: [email protected].
Received for publication 2 December 2002 and accepted in revised form 8 January 2003.
R.D.M. and A.P. contributed equally to this work.
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFN-␥, ␥-interferon;
IL, interleukin; mAb, monoclonal antibodies; PMA, phorbol-myristate-acetate.
in allogeneic combinations, in fact, often fail when tested in spontaneously diabetic NOD recipients (21,24,25).
In view of our preliminary data on CD154 monotherapy in NOD mice and on the synergy obtained by simultaneous targeting of CD45RB and CD154 in models of islet allo- transplantation into chemically diabetic recipients, we tested the efficacy of this combination treatment in NOD mice, in which allorecognition and recurrence of autoim- munity concur to determine islet allograft failure.
RESEARCH DESIGN AND METHODS
Animals.Female NOD mice (Taconic Farms, Germantown, NY) were moni- tored for blood glucose levels until diabetes onset and were used as recipients of C57BL/6 (B6; Hilltop Laboratories, Scottdale, PA) islet grafts after at least three nonfasting blood glucose readings⬎350 mg/dl. All mice were certified to be free of common laboratory animal pathogens and were housed in virus antibody–free animal facilities, having free access to autoclaved feed and water. All animal manipulations were conducted under protocols approved by the Institutional Animal Care and Use Committee.
Islet isolation and transplantation.Murine islets were isolated from B6 donors as previously described (26). After overnight culture at 37°C, 5% CO2
in CMRL-1066 medium (Gibco, Long Island, NY) supplemented with 10% FCS (Hyclone, Logan, UT), 2 mmol/lL-glutamine, 100 units/ml penicillin, 100g/ml streptomycin, and 25 mmol/l HEPES buffer (Mediatech, Herndon, VA), 600 – 700 IEQ were transplanted under the kidney capsule of NOD recipients (21).
Blood glucose levels were then monitored biweekly using an Elite glucometer (Bayer, Tarrytown, NY). Diabetes recurrence was defined as two consecutive nonfasting blood glucose readings⬎250 mg/dl. Long-term graft survival was defined as graft function persisting⬎120 days.
Antibodies and treatments.The hamster anti-mouse CD154 mAb (MR1) was purchased from Taconic Biotechnology. The rat anti-mouse CD45RB mAb was purified by affinity chromatography on protein-G columns from super- natants of cultured MB23G2 hybridoma cells (ATCC, Rockville, MD) (8).
Recipients were treated with either 100g of anti-CD45RB mAb or 500g of anti-CD154 mAb alone or in combination, intraperitoneally injected on days
⫺1, 0, and 5 after transplantation (acute treatment regimens). Alternatively, anti-CD154 mAb was administered weekly (chronic treatment), and/or anti- CD45RB mAb was given repeating the induction protocol semimonthly (two injections on consecutive days followed by a third injection on the fifth day) until day 50 or indefinitely.
Histology and immunohistochemistry.At selected time points, paraffin- embedded sections of grafted kidneys were stained with hematoxylin and eosin to assess graft morphology. Immunostaining on frozen sections was performed by the use of biotinylated antibodies directed to CD4 (L3T4) or CD8a (Ly-2; BD-PharMingen, San Diego, CA), followed by streptavidin- horseradish peroxidase and aminoethyl carbazole (AEC). Control slides, where the primary antibody was omitted, were always processed in parallel.
Flow cytometry analysis. Phenotypic analysis of splenocytes was per- formed 10 –12 days after transplantation by the use of mAb directed to CD3 (⑀-chain), CD4 (L3T4), CD8 (Ly-2), CD25, and CD45RB (16A clone; BD- PharMingen). Antibodies were either directly conjugated to fluorochromes (APC, FITC, and PE) or biotinylated. Biotinylated antibody binding was detected by incubation with PE-conjugated streptavidin. Analysis of the samples was performed on a FACScalibur flow cytometer (BD-PharMingen), acquiring at least 5,000 events per sample. Unstained and control isotype- treated samples were always processed in parallel.
Response to phorbol-myristate-acetate and cytokines.For assessing the effect of the different treatments on the response to selected cytokines, spleen cells obtained from treated and control animals 10 –12 days after transplan- tation were cultured in Iscove’s media (Gibco) supplemented with 10%
heat-inactivated FCS, and 2--mercaptoethanol (2-ME; TCM), in the presence of phorbol-myristate-acetate (PMA) alone or with interleukin (IL)-2, IL-4, or IL-7 (10 ng/ml; Peprotech, Rocky Hill, NJ) at 2⫻105cells/well. This time point was selected for this and all following mechanistic studies to compare immunological profiles of treated mice bearing a functional graft with control mice at graft rejection. After 48 h of incubation, plates were pulsed with tritiated thymidine ([3H]Thy; 1Ci/well), and incorporation was measured 6 h later on a liquid scintillation-counter and expressed as counts per minute.
Anti-CD3 stimulation.Splenocytes from NOD recipients (4⫻106cells) were harvested 10 –12 days after transplantation and cultured in 24-well plates in the presence of anti-CD3 mAb (1g/ml) for 72 h in TCM. After incubation, 20,000 cells per well were plated in 96-well plates in the presence of 10 ng/ml of IL-2, IL-4, or IL-7. After overnight culture, plates were pulsed with [3H]Thy, and its incorporation was measured after 6 h.
In other experiments, splenocyte supernatants were collected after 72 h of culture in the presence of anti-CD3 mAb and were assayed by enzyme-linked immunosorbent assay for IL-4, IL-10 (Biosource, Camarillo, CA), IL-2, and
␥-interferon (IFN-␥; R&D Systems, Minneapolis, MN).
Mixed lymphocyte reaction.Splenocytes from NOD recipients (2⫻105) were cultured in the presence of mitomycin-treated stimulator splenocytes obtained from B6 (donor), NOD (self), or Balb/c (third party) mice at a 1:1 ratio. After 3 days (37°C, 5% CO2), plates were pulsed with [3H]Thy, and incorporation was measured 8 h later.
Graft cytokine analysis.Islet grafts dissected free from the kidney surface (10 –12 days posttransplantation) were snap-frozen and stored at⫺80°C until RNA extraction (RNA NOW-LM kit; Biogentex, Seabrook, TX). cDNA was created using Superscript reverse transcriptase (Gibco), and quantitative PCR analysis of cytokine mRNA steady-state levels was performed with the LightCycler instrument (Roche) (26). PCR conditions were 1 min at 94°C, 35 cycles of 1 s at 94°C, 9 s at 55°C, and 12 s at 72°C. Cytokine and glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) messages were amplified using the following primer pairs: IL-2 5⬘CTCCTGAGCAGGATGGAGAATT3⬘(forward), 5⬘CGCAGAGGTCCAAGTGTAGCT3⬘(reverse); IL-4 5⬘GGCATTTTGAACGAG GTCACA3⬘forward, 5⬘AGGACGTTTGGCACATCCAT3⬘reverse; IL-10 5⬘TTT GAATTCCCTGGGTGAGAA3⬘(forward), 5⬘ACAGGGGAGAAATCGATGACA3⬘ (reverse); IFN-␥5⬘CTCTTCTTGGATATCTGGAGGAACTGG3⬘(forward), 5⬘CAT TGAATGCTTGGCGCTGGACCTGTG3⬘(reverse); transforming growth factor- 5⬘GGAGCAACATGTGGAACTCTACCAG3⬘(forward), 5⬘GACGTCAAAAGACA GCCACTCAGG3⬘(reverse); GAPDH 5⬘CTCAACTACATGGTCTACA3⬘(forward), 5⬘CCATTCTCGGCCTTGACTG3⬘(reverse). Initial starting concentrations of cDNA were determined by arbitrary units, and the ratio of cytokine to GAPDH was used to normalize the different samples.
Statistical analysis.The Statistica software (Statsoft, Tulsa, OK) was used for statistical analysis. Data are expressed as mean and SD or SE. Kaplan- Meier analysis was performed for diabetes-free survival determination, and differences were assessed with the Mantel-Cox log-rank test. Two-tailed, unpaired, or paired Student’sttest was used, whenever appropriate.P⬍0.05 was considered significant.
RESULTS
Peritransplant administration of antibodies directed against CD45RB and CD154 significantly prolongs survival of islet allografts in NOD mice. Allogeneic islets transplanted in untreated spontaneously diabetic NOD mice (controls) were invariably lost within 15 days, with a mean survival time (⫾SD) of 10⫾2.2 days (n⫽8).
A short treatment course with anti-CD154 mAb (days⫺1, 0, and 5) resulted in a measurable, although not dramatic, prolongation of graft survival (18.6 ⫾ 3.8 days, n ⫽ 5;
Cox-Mantel testP⫽0.002 versus controls). Peritransplant treatment with anti-CD45RB mAb alone resulted in com- parable prolongation of graft survival (18.4⫾2.5 days;n⫽ 5;P⫽ 0.0008; Fig. 1A).
Administration of both mAb in combination during the peritransplant period led to remarkable prolongation of graft survival (47.2⫾4.3 days;n⫽ 5). Statistical analysis showed highly significant differences between the group that received the combination treatment and the groups that received either antibody alone or no treatment. This result is consistent with the reported synergistic effect observed in an allogeneic setting when a similar combina- tion of mAb was used (11).
Extended administration of anti-CD45RB and anti- CD154 mAb results in further prolongation of graft survival.We recently reported that extended administra- tion of anti-CD154 mAb seemed more effective than a short-course treatment in prolonging allograft acceptance in spontaneously diabetic NOD mice (21). On the basis of this observation, we explored the effect of weekly admin- istrations of anti-CD154 mAb after the peritransplant treat- ment with both mAb. With this regimen, graft survival was prolonged (59⫾32 days;n⫽ 5) but was not significantly
ISLET TRANSPLANT WITH␣CD45RB AND␣CD154 AB IN NOD
different from that observed in the group that received the combination of anti-CD45RB and anti-CD154 mAb during the peritransplant period only (P⫽0.68) or that observed in a group that received prolonged treatment with anti- CD154 alone (47 ⫾ 23 days, n ⫽ 7; P ⫽ 0.67; Fig. 1B).
Extending the administration of anti-CD45RB mAb alone, by repeating the course of administration (three injec- tions) every 15 days, did not provide additional advantage over the peritransplant administration of the same mAb alone (19.2⫾ 5.6 days,n ⫽5;P⫽ NS; Fig. 1B).
When anti-CD154 mAb was given during the peritrans- plant period in association with chronic anti-CD45RB mAb therapy (until day 50), prolongation of the graft survival was observed (64.8⫾ 31.5 days;n ⫽ 5), although it was not statistically different from that achieved using peri-
transplant combination therapy with anti-CD154 plus anti- CD45RB mAb (Fig. 1B). In this group, graft loss occurred after discontinuation of the anti-CD45RB therapy (50 days posttransplantation), in 4 of 5 recipients, suggesting that extended administration of the antibody was required for maintenance of islet graft function. Therefore, we exam- ined the effects of indefinite anti-CD45RB therapy, in addition to peritransplant anti-CD154 treatment. This strategy resulted in a significant prolongation of graft survival and long-term graft acceptance (⬎120 days) in 2 of 5 recipients (88.7 ⫾ 33.3 days; P ⫽ 0.00015 versus controls;Pⱕ 0.04 versus all treated groups; Fig. 1B).
Treatment with anti-CD45RB and anti-CD154 mAb induces a CD45RB isoform shift.Analysis of the T-cell subset distribution in splenocytes and peripheral blood of NOD mice assessed by flow cytometry revealed that none of the treatments altered the overall proportion of CD3⫹ T-cells or the ratio of CD4⫹:CD8⫹cells, when compared with untreated NOD mice (not shown). Similarly, no difference in the expression of the IL-2 high-affinity recep- tor (CD25) was observed on CD4⫹and CD8⫹T-cells (data not shown), suggesting that the protection afforded by the treatment was not associated with alterations in T-regula- tory cells (e.g., CD4⫹CD25⫹) or T-cell activation or with a change in the normal proportion of T-cell subsets.
It has been previously reported that treatment with anti-CD45RB mAb in B6 mice resulted in a shift of CD45RB isoform from the high (CD45RBhi) to the low (CD45RBlow) expression on CD4⫹T-cells (8,10) and that the concomi- tant use of anti-CD154 mAb did not alter this phenomenon (11). In the present study, no measurable shift in the CD45RB expression on CD4⫹ T-cells was observed in NOD recipients that were treated with the anti-CD45RB mAb alone. Although the proportion of CD4⫹T-cells that expressed a CD45RBlow phenotype was slightly higher than that observed in control animals that received a transplant, this was not statistically significant (mean ⫾ SD ⫽ 64 ⫾ 1.7% vs. 50 ⫾ 15.3%, respectively; two-tailed, unpaired t test P ⫽ NS). Surprisingly, animals that re- ceived the combination therapy showed an increased rate of CD4⫹CD45RBlow cells (75 ⫾ 3.4%; P ⫽ 0.021 versus transplanted controls; Fig. 2A and B). These results sug- gest that in spontaneously diabetic NOD mice, unlike in B6 mice (11), administration of anti-CD45RB mAb alone is not sufficient to induce a significant shift in the CD45RB isoform expression on CD4⫹T-cells and that the concom- itant administration of anti-CD154 mAb allows for the occurrence of this phenomenon.
To test whether the age of the recipient plays a role in determining the efficacy of the anti-CD45RB mAb treat- ment in promoting CD45RB isoform shift, we performed additional experiments using 1-week-old NOD mice. Ani- mals received the short-course treatment with the anti- body directed to CD45RB either alone or in combination with anti-CD154 mAb, and phenotypic analysis was per- formed on spleen cells after 1 and 2 weeks from the last injection. In contrast to what was observed in adult diabetic NOD mice, when CD45RB mAb alone was admin- istered, young prediabetic NOD mice showed a dramatic shift from CD45RBhi to CD45RBlow isoform expression that was comparable to that observed in adult animals that
FIG. 1. Allogeneic islet graft survival in spontaneously diabetic NOD mice. NOD mice that received a transplant were treated acutely (ac) with anti-CD154 or anti-CD45RB mAb on daysⴚ1, 0, and 5 (induction).
Chronic (chr) treatment groups received, after induction, either weekly administration of anti-CD154 or three injections (same sched- ule as the induction) of the anti-CD45RB mAb semimonthly.A: Prolon- gation of graft survival was observed in all treated groups (Cox-Mantel testP<0.002 versus controls). Administration of the combination of both antibodies acutely resulted advantageously when compared with acute single treatments or with chronic anti-CD45RB mAb (P<0.0018) but not with the group that received chronic anti-CD154 mAb (NS).B:
Prolongation of graft survival was observed when, after induction with both antibodies, anti-CD154 administration was repeated weekly (Œ), or anti-CD45RB semimonthly administration was maintained until day 50 PO (f), or anti-CD45RB treatment was given indefinitely (⽧;P<
0.04 versus all treated groups).
were treated with the combination of both antibodies (not shown).
Phenotypic analysis of the CD45RB isoforms on CD8⫹ T-cells showed a pronounced increase of the CD45RBlow isoform expression that occurred both in animals that were treated with the anti-CD45RB mAb only and, to a higher degree, in those that were treated with the combi- nation of anti-CD45RB and anti-CD154 mAb. In control mice, the expression of the CD45RBlowisoform on CD8⫹ T-cells was 20.9 ⫾ 4.7% and rose to 37.3 ⫾ 8.2% in anti-CD45RB–treated recipients and to 75⫾ 3.5% in ani- mals that received combination therapy (Fig. 2Aand B).
Treatment with anti-CD45RB and anti-CD154 mAb effectively limits CD8ⴙT-cell invasion into the peri- islet infiltrate. Histological analysis of the grafted kid- neys showed peri-islet mononuclear cell infiltration with preservation of the islet morphology in the long-term surviving grafts. Immunohistochemistry of the grafts ob- tained 10 –12 days posttransplantation or from long-term accepted implants showed a reduction of the relative
proportion of CD8⫹ T-cells within the infiltrate in the animals that received anti-CD45RB mAb in combination with anti-CD154 mAb, when compared with nontreated or anti-CD154 mAb–treated recipients (Fig. 3). This finding is consistent with what has been previously described in an allogeneic combination (11).
Intragraft cytokine mRNA levels do not differ in experimental and control groups. For analyzing whether any of the immunomodulatory treatments had any sizable effect on the intragraft cytokine expression, islet grafts of treated or untreated animals were obtained 10 –12 days posttransplantation. Cytokine steady-level ex- pression assessed by quantitative RT-PCR showed no difference in the levels of IL-10, IFN-␥, IL-2, and transform- ing growth factor-between the different groups (Table 1).
In vitro lymphocyte proliferation reveals an in- creased response to IL-7 after CD3-stimulation in anti-CD45RB– and anti-CD154 –treated animals.Pro- liferation of NOD recipient’s splenocytes (10 –12 days posttransplantation) in response to IL-2, IL-4, or IL-7 in the
FIG. 2. FACS analysis of CD45RB isoform expression on T-cells.A: FACS profiles of CD45RB isoform expression on CD4ⴙand CD8ⴙT-cells of NOD mice treated with the indicated regimens (one representative experiment).B: CD45RB isoform expression on CD4ⴙand CD8ⴙ cells expressed as meanⴞSD of five individual experiments; significant shifts were observed in both CD4ⴙand CD8ⴙcell subsets in the group that received the anti-CD45RB and anti-CD154 mAb therapy and in CD8ⴙcells in animals that were treated with anti-CD45RB only. *Pⴝ0.02; **P ⴝ0.01; ***Pⴝ0.000002.
FIG. 3. Histopathological analysis of islet grafts. Islet grafts were collected from control NOD mice 10 days posttrans- plantation (A–C) or from NOD mice that were treated with the anti-CD45RB and anti-CD154 mAb therapy 120 days after transplantation (D–F). Hematoxylin and eosin stain- ing (H&E) was performed on paraffin-embedded sections (A andD). Immunohistochemistry for CD4ⴙ (B andE) and CD8ⴙ(C andF) T-cell subsets was performed on frozen sections. Control animals showed a classic pattern of rejec- tion, with mononuclear cells infiltrating the graft, and loss of islet morphology. Conversely, recipients treated with anti-CD45RB and anti-CD154 mAb therapy showed only peri-insular mononuclear infiltration, with preservation of islet structure. A remarkable reduction in CD8ⴙT-cell was also observed in this group, in grafts analyzed both at 10 days (not shown) and after 120 days posttransplantation.
CD4ⴙcells were equally represented in both groups.
ISLET TRANSPLANT WITH␣CD45RB AND␣CD154 AB IN NOD
presence of PMA was not affected by any of the treatment protocols (Fig. 4A). Likewise, proliferation in response to anti-CD3 mAb in the presence of IL-2 or IL-4 revealed no differences between any of the treatment groups or un- treated controls. However, an increased response to IL-7 after CD3 stimulation was observed in the splenocytes obtained from animals that received the double treatment (Fig. 4B). Mixed lymphocyte reaction (MLR) showed no difference among experimental groups in response to mitomycin-treated, donor-specific, third-party or synge- neic cells (not shown), indicating that the prolonged graft survival achieved was not associated with a generalized immunosuppressive effect or in vitro donor-specific hypo- responsiveness. Furthermore, these data indicate that the prolonged graft survival observed was not consequent to impaired proliferation potential and/or to reduced respon- siveness to cytokines.
Treatment with anti-CD45RB and anti-CD154 mAb induces enhanced IFN-␥ production by CD3-stimu- lated lymphocytes. Supernatants from anti-CD3 mAb–
stimulated splenocytes obtained from transplanted NOD 10 –12 days after transplantation mice showed no differ- ence in IL-4 levels regardless of the treatment received.
However, treatment with anti-CD45RB and anti-CD154 mAb led to a dramatic increase in IFN-␥production, when compared with untreated controls that received a trans- plant (unpaired, two-tailed ttestP⫽ 0.0022), or to naı¨ve NOD mice that did not receive a transplant (P⫽0.013; Fig.
5A). Similarly, a substantial increase in IL-10 levels was observed in the group that received combination therapy, when compared with untreated controls, although it did not reach statistical significance (Fig. 5B).
DISCUSSION
Allotransplantation in spontaneously diabetic NOD mice represents a stringent model for analysis of the concurrent effects of allorecognition and recurrence of autoimmunity on islet graft fate. It is common knowledge that strategies of immunosuppression that promote long-term survival of
FIG. 4. Splenocyte responses to mitogens in vitro. Spleno- cytes obtained from NOD mice 10 –12 days after transplan- tation were cultured in the presence of PMA and IL-2, IL-4, or IL-7. Thymidine incorporation (expressed as meanⴞSE counts per minute [CPM] of three individual experiments) showed no difference in the proliferative response between the indicated groups (A). Proliferative response to IL-2 and IL-4 after anti-CD3 mAb stimulation also showed no differ- ence among experimental groups, whereas an enhanced proliferation was observed in the anti-CD45RB and anti- CD154 mAb–treated group stimulated with IL-7 (meanⴞSE CPM of three individual experimentsB). *Pⴝ0.003.
TABLE 1
Intragraft cytokine mRNA expression
Treatment IFN-␥ TGF- IL1- IL-10
Not treated 2.57⫾1.22 (6) 3.7⫾3.59 (6) 4.33⫾3.45 (6) 2.17⫾1.64 (4)
Combination 1.79⫾0.6 (5) 2.44⫾1.6 (5) 2.09⫾0.76 (5) 1.85⫾1.04 (2)
Data are arbitrary units (average for the number of grafts analyzed). Cytokine steady-state levels were assessed in grafts obtained 10 –12 days after transplantation by real-time RT-PCR. No significant differences were detected among animals that received combination treatment and controls.
islet allografts in chemically diabetic mice often prove themselves ineffective in diabetic NOD recipients (21, 24,25). Consistent with these observations, we have re- ported that treatment with anti-CD154 mAb induced long- term survival of B6 islet allografts (⬎100 days) in young chemically induced diabetic NOD mice, in which no islet- specific autoimmunity occurs (21), whereas an identical therapeutic protocol resulted only in prolongation, with- out long-term survival, of islet allografts in spontaneously (autoimmune) diabetic NOD mice (21). Indefinite islet allograft survival in spontaneously diabetic NOD mice has so far been obtained only with preconditioning of the recipients with cytoablative therapies followed by alloge- neic (donor-specific) bone marrow transplantation (22,23).
The synergistic effect of a peritransplant treatment associating anti-CD45RB and anti-CD154 mAb was origi- nally explored in chemically diabetic mice that received a transplant of allogeneic islets (in the absence of islet- specific autoimmunity), in which it was able to induce long-term graft acceptance and donor-specific tolerance (11). In the present study, this combination therapy indeed
led to measurable prolongation of graft survival but did not allow for indefinite allograft acceptance in spontane- ously diabetic NOD mice, suggesting an important contrib- uting role for autoimmunity recurrence.
Extended administration of the anti-CD45RB mAb in combination with peritransplant anti-CD154 mAb showed a synergistic effect resulting in dramatic prolongation of graft survival and long-term graft acceptance in 40% of the recipients. Chronic administration of the anti-CD45RB mAb was critical for prolonging graft acceptance in the NOD mouse model, in contrast to what was observed in the allogeneic combination previously tested (11).
In B6 mice, the beneficial effect of the treatment with anti-CD45RB mAb was associated with CD45RB isoform shift (from high to low) on CD4⫹ T-cells (8 –11). This altered isoform expression has been postulated as one of the mechanisms by which anti-CD45RB mAb therapy may alter T-cell activation signaling and promote immune tolerance (11). At variance, in the adult spontaneously diabetic NOD mice used as islet recipients, therapy with anti-CD45RB mAb alone induced only a small shift in CD45RB isoform expression on CD4⫹T-cells, whereas a combination of mAb led to a significant shift toward the CD45RBlowphenotype. It is interesting that administration of anti-CD45RB mAb alone was able to induce a dramatic shift to the CD45RBlow expression in young prediabetic NOD mice. It might be speculated that after onset of autoimmune diabetes, the activation state of immune cells could be altered, resulting in a reduced sensitivity to the anti-CD45RB mAb–induced isoform shift in adult NOD mice.
Our data support an important role for this phenotypic change in the modulation of immune responsiveness, because it correlated with the treatment supporting longer graft survival. In addition, the group that received the combinatory treatment showed a dramatic shift to CD45RBlowexpression in the CD8⫹T-cell population that was reduced or absent in the other groups.
Although the mechanisms underlying the isoform shift are still not completely understood, the CD4⫹CD45RBlow population has been associated with downregulation of immune responses and with predominantly Th2 cytokine production (27–29). In our study, the beneficial effect of the treatment with anti-CD45RB and anti-CD154 mAb on graft survival was paralleled by an increased CD4⫹CD45RBlow cell population but was not associated with a classic skewing toward a Th2 response. In vitro assessment of cytokine production after CD3 stimulation revealed elevated levels of the Th2 cytokine IL-10 and of the predominantly Th1 cytokine IFN-␥ by splenocytes obtained from animals that were treated with a combina- tion of anti-CD45RB and anti-CD154 mAb, when compared with animals that received either mAb alone or were not treated. A similar cytokine production pattern, distinct from the generally accepted Th1, Th2, and Th0 classifica- tion, has been associated with a T-cell subset character- ized by low proliferative potential, high production of IL-10 and IFN-␥, and immune regulatory properties both in vitro and in vivo (30). In particular, this cell subset was able to efficiently prevent CD4⫹CD45RBhi-induced colitis in SCID mice in a manner comparable to that observed with CD4⫹CD45RBlowcells co-transfer (29 –30).
FIG. 5. Cytokine production after anti-CD3 mAb stimulation in vitro.
Supernatants of splenocytes obtained from NOD mice 10 –12 days after transplantation were collected after 48 h of incubation with an anti- CD3 mAb and showed increased production of INF-␥(A) and IL-10 (B) in the group that received anti-CD45RB and anti-CD154 mAb as assessed by enzyme-linked immunosorbent assay. *Pⴝ0.0022. Results are expressed as meanⴞSE of at least three separate experiments.
ISLET TRANSPLANT WITH␣CD45RB AND␣CD154 AB IN NOD
Furthermore, in our study, the protective effect of the treatment was not related to a substantial deletion of selected T-cell subsets, because FACS analysis of spleno- cytes and peripheral blood lymphocytes showed no differ- ence in the relative proportion of CD4⫹ or CD8⫹ cell populations. In addition, lymphocyte proliferative re- sponses to IL-2 and IL-4, as well as to alloantigens, and to anti-CD3 mAb were unaffected by the treatments, suggest- ing a largely preserved immune responsiveness to relevant antigens. It is interesting that the combination therapy led to an increased response to IL-7 after anti-CD3 stimula- tion, suggesting an increased sensitivity of a T-cell sub- set(s) to this cytokine. IL-7 has been shown to induce T-cell proliferation, promoting CD8⫹T-cell expansion and stimulating IFN-␥ production (31). Also, IL-7 could pro- mote expansion of thymus-derived regulatory cells, able to prevent diabetes occurrence when transferred, in combi- nation with spleen cells obtained from spontaneously diabetic NOD into NOD-Scid mice (32). A more commonly analyzed regulatory T-cell subset (CD4⫹CD25⫹) was un- altered by all treatments, suggesting that prolonged graft survival cannot be explained on the basis of a quantitative difference in this population.
Histological analysis of the grafts showed preservation of islet morphology in the presence of an intense peri-islet mononuclear cell infiltrate in animals that received the combination treatment. This observation is compatible with the known pattern of “benign peri-insulitis” and is in contrast with the “malignant insulitis” observed in reject- ing animals in which the islet structure was completely lost to intra-islet infiltrating mononuclear cells (33). As- sessment of graft-infiltrating cell subsets revealed a marked reduction of CD8⫹ T-cells, whereas no gross differences in CD4⫹ T-cell subset infiltration were ob- served. A reduction of CD8⫹ T-cells infiltrating islet allografts was previously reported in animals that were treated with anti-CD45RB mAb alone or in combination with anti-CD154 mAb in nonautoimmune diabetic mice (11).
In our study, anti-CD45RB mAb treatment was associ- ated with a sizable shift to CD45RBlow isoform of CD8⫹ T-cells, and the shift was enhanced by the combination with anti-CD154 mAb. This is at variance with the isoform shift behavior of CD4⫹ cells, in which the administration of CD45RB mAb alone did not result in any significant isoform shift in adult animals. This observation reveals different signaling requirements for CD4⫹ and CD8⫹ subsets and might contribute to explaining the differential behavior of the two subsets in terms of graft infiltrating efficacy. In this regard, a role for CD45 in regulating integrin-mediated adhesion of macrophages and T-cells has been described (11,34,35), as well as a partial deple- tion of CD8⫹cells in lymph nodes after anti-CD45RB mAb treatment in rodents (11). It is therefore conceivable that these mechanisms might interfere with CD8⫹ T-cell mi- gration to the graft site.
The NOD mouse has been indicated as characterized by a generalized defect in tolerance induction susceptibility (20,21), and indeed our data are indirectly in agreement with this observation, showing the requirement for addi- tional immunomodulatory treatment to promote immuno- logical alterations that are obtained with milder treatment
in nonautoimmune diabetic mice. The reasons for the observed differences are not yet clear, but it is conceivable that the numerous immunological abnormalities peculiar to the NOD mouse might account, at least in part, for them (36).
Nonetheless, we have now demonstrated that prolonged islet allograft survival can be achieved in spontaneously diabetic NOD recipients without harsh preconditioning regimens and bone marrow transplantation. The long-term survival of islets that we observed in 40% of the recipients is paralleled by a remarkably preserved immune respon- siveness to donor-specific and third-party allostimulation.
It is interesting that these results demonstrate that agents that are able to induce tolerance in certain circumstances may still be useful in producing prolonged immunosup- pression in resistant hosts. In this regard, it may not be surprising that the changes in the host immune system previously associated with anti-CD45RB–mediated toler- ance were either minimized or absent in this setting. We have at this time no explanation for the observed variabil- ity of graft survival (in which 40% survive long-term, whereas the rest only show prolongation), a phenomenon that has been often reported and might be due entirely to normal biological interindividual variability, even within an inbred strain.
Because there are no described diabetogenic effects characterizing the reagents used in our study, we believe that exploiting these strategies of T-cell signaling modula- tion and co-stimulatory blockade might prove a viable strategy for the treatment of islet transplantation recipi- ents.
ACKNOWLEDGMENTS
This work was funded partly through a grant from Juvenile Diabetes Research Foundation (1-2000-242 to L.I.) and through ongoing support by the Diabetes Research Insti- tute Foundation (Hollywood, FL).
We thank Kevin Johnson for the excellent technical assistance in the histology and Jim Philips for FACS analysis expertise.
REFERENCES
1. Alejandro R, Lehmann R, Ricordi C, Kenyon NS, Angelico MC, Burke G, Esquenazi V, Nery J, Betancourt AE, Kong SS, Miller J, Mintz DH:
Long-term function (6 years) of islet allografts in type 1 diabetes.Diabetes 46:1983–1989, 1997
2. Shapiro AM, Lakey JR, Ryan EA, Korbutt GS, Toth E, Warnock GL, Kneteman NM, Rajotte RV: Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regi- men.N Engl J Med343:230 –238, 2000
3. Ryan EA, Lakey JR, Rajotte RV, Korbutt GS, Kin T, Imes S, Rabinovitch A, Elliott JF, Bigam D, Kneteman NM, Warnock GL, Larsen I, Shapiro AM:
Clinical outcomes and insulin secretion after islet transplantation with the Edmonton protocol.Diabetes50:710 –719, 2001
4. Ryan EA, Lakey JR, Paty BW, Imes S, Korbutt GS, Kneteman NM, Bigam D, Rajotte RV, Shapiro AMJ: Successful islet transplantation. Continued insulin reserve provides long-term glycemic control. Diabetes51:2148 – 2157, 2002
5. Pileggi A, Ricordi C, Alessiani M, Inverardi L: Factors influencing islet of Langerhans graft function and monitoring.Clin Chim Acta310:3–16, 2001 6. Lazarovits AI, Poppema S, Zhang Z, Khandaker M, Le Feuvre CE, Singhal SK, Garcia BM, Ogasa N, Jevnikar AM, White MH, Singh G, Stiller CR, Zhong RZ: Prevention and reversal of renal allograft rejection by antibody against CD45RB.Nature380:717–720, 1996
7. Davies JD, O’Connor E, Hall D, Krahl T, Trotter J, Sarvetnick N: CD4(⫹) CD45RB low-density cells from untreated mice prevent acute allograft rejection.J Immunol163:5353–5357, 1999
8. Basadonna GP, Auersvald L, Khuong CQ, Zheng XX, Kashio N, Zekzer D, Minozzo M, Qian H, Visser L, Diepstra A, Lazarovits AI, Poppema S, Strom TB, Rothstein DM: Antibody-mediated targeting of CD45 isoforms: a novel immunotherapeutic strategy.Proc Natl Acad Sci U S A95:3821–3826, 1998 9. Auersvald LA, Rothstein DM, Oliveira SC, Khuong CQ, Onodera H, Lazarovits AI, Basadonna GP: Indefinite islet allograft survival in mice after a short course of treatment with anti-CD45 monoclonal antibodies.Trans- plantation63:1355–1358, 1997
10. Fecteau S, Basadonna GP, Freitas A, Ariyan C, Sayegh MH, Rothstein DM:
CTLA-4 up-regulation plays a role in tolerance mediated by CD45. Nat Immunol2:58 – 63, 2001
11. Rothstein DM, Livak MF, Kishimoto K, Ariyan C, Qian HY, Fecteau S, Sho M, Deng S, Zheng XX, Sayegh MH, Basadonna GP: Targeting signal 1 through CD45RB synergizes with CD40 ligand blockade and promotes long term engraftment and tolerance in stringent transplant models.J Immunol 166:322–329, 2001
12. Yamada A, Sayegh MH: The CD154-CD40 costimulatory pathway in trans- plantation.Transplantation73:S36 –S39, 2002
13. Kirk AD, Harlan DM, Armstrong NN, Davis TA, Dong Y, Gray GS, Hong X, Thomas D, Fechner JH, Knechtle SJ: CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc Natl Acad Sci U S A 94:8789 – 8794, 1997
14. Kirk AD, Burkly LC, Batty DS, Baumgartner RE, Berning JD, Buchanan K, Fenchner JH, Germond RL, Kampen RL, Patterson NB, Swanson SJ, Tadaki DK, TenHoor CN, White L, Knechtle SJ, Harlan DM: Treatment with humanized monoclonal antibody against CD154 prevents acute renal allograft rejection in non-human primates.Nat Med5:686 – 693, 1999 15. Kenyon NS, Chatzipetrou M, Masetti M, Ranuncoli A, Oliveira M, Wagner
JL, Kirk AD, Harlan DM, Burkly LC, Ricordi C: Long-term survival and function of intrahepatic islet allografts in rhesus monkeys treated with humanized anti-CD154.Proc Natl Acad Sci U S A96:8132– 8137, 1999 16. Kenyon NS, Fernandez LA, Lehmann R, Masetti M, Ranuncoli A, Chatzi-
petrou M, Iaria G, Han D, Wagner JL, Ruiz P, Berho M, Inverardi L, Alejandro R, Mintz DH, Kirk AD, Harlan DM, Burkly LC, Ricordi C:
Long-term survival and function of intrahepatic islet allografts in baboons treated with humanized anti-CD154.Diabetes48:1473–1481, 1999 17. Early GS, Zhao W, Burns CM: Anti-CD40 ligand antibody treatment
prevents the development of lupus-like nephritis in a subset of New Zealand black x New Zealand white mice. Response correlates with the absence of an anti-antibody response.J Immunol157:3159 –3164, 1996 18. Durie FH, Rava RA, Foy TM, Aruffo A, Ledbetter JA, Noelle RJ: Prevention
of collagen-induced arthritis with an antibody to gp39, the ligand for CD40.
Science261:1328 –1330, 1993
19. Balasa B, Krahl T, Patstone G, Lee J, Tisch R, McDevitt HO, Sarvetnick N:
CD40 ligand-CD40 interactions are necessary for the initiation of insulitis and diabetes in nonobese diabetic mice.J Immunol159:4620 – 4627, 1997 20. Markees TG, Serreze DV, Phillips NE, Sorli CH, Gordon EJ, Shultz LD, Noelle RJ, Woda BA, Greiner DL, Mordes JP, Rossini AA: NOD mice have a generalized defect in their response to transplantation tolerance induc- tion.Diabetes48:967–974, 1999
21. Molano RD, Berney T, Li H, Cattan P, Pileggi A, Vizzardelli C, Kenyon NS, Ricordi C, Burkly LC, Inverardi L: Prolonged islet graft survival in NOD mice by blockade of the CD40-CD154 pathway of T-cell costimulation.
Diabetes50:270 –276, 2001
22. Li H, Kaufman CL, Ildstad ST: Allogeneic chimerism induces donor-specific tolerance to simultaneous islet allografts in nonobese diabetic mice.
Surgery118:192–197, 1995
23. Seung E, Iwakoshi N, Woda BA, Markees TG, Mordes JP, Rossini AA, Greiner DL: Allogeneic hematopoietic chimerism in mice treated with sublethal myeloablation and anti-CD154 antibody: absence of graft-versus- host disease, induction of skin allograft tolerance, and prevention of recurrent autoimmunity in islet-allografted NOD/Lt mice.Blood95:2175–
2182, 2000
24. Guo Z, Mital D, Shen J, Chong AS, Tian Y, Foster P, Sankary H, McChesney L, Jensik SC, Williams JW: Immunosuppression preventing concordant xenogeneic islet graft rejection is not sufficient to prevent recurrence of autoimmune diabetes in nonobese diabetic mice. Transplantation 65:
1310 –1314, 1998
25. Stegall MD, Loberman Z, Ostrowska A, Coulombe M, Gill RG: Autoimmune destruction of islet grafts in the NOD mouse is resistant to 15-deoxysper- gualin but sensitive to anti-CD4 antibody.J Surg Res64:156 –160, 1996 26. Berney T, Molano RD, Cattan P, Pileggi A, Vizzardelli C, Oliver R, Ricordi
C, Inverardi L: Endotoxin-mediated delayed islet graft function is associ- ated with increased intra-islet cytokine production and islet cell apoptosis.
Transplantation71:125–132, 2001
27. Read S, Mauze S, Asseman C, Bean A, Coffman R, Powrie F: CD38(⫹) CD45RB(low) CD4(⫹) T cells: a population of T cells with immune regulatory activities in vitro.Eur J Immunol28:3435–3447, 1998 28. Powrie F, Correa-Oliveira R, Mauze S, Coffman RL: Regulatory interactions
between CD45RBhighand CD45RBlowCD4⫹T cells are important for the balance between protective and pathogenic cell-mediated immunity.J Exp Med179:589 – 600, 1994
29. Singh B, Read S, Asseman C, Malmstrom V, Mottet C, Stephens LA, Stepankova R, Tlaskalova H, Powrie F: Control of intestinal inflammation by regulatory T cells.Immunol Rev182:190 –200, 2001
30. Groux H, O’Garra A, Bigler M, Rouleau M, Antonenko S, de Vries JE, Roncarolo MG: A CD4⫹ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis.Nature389:737–742, 1997
31. Kasper LH, Matsuura T, Khan IA: IL-7 stimulates protective immunity in mice against the intracellular pathogen, Toxoplasma gondii.J Immunol 155:4798 – 4804, 1995
32. Herbelin A, Gombert JM, Lepault F, Bach JF, Chatenoud L: Mature mainstream TCR alpha beta⫹CD4⫹ thymocytes expressing L-selectin mediate “active tolerance” in the nonobese diabetic mouse.J Immunol 161:2620 –2628, 1998
33. Gazda LS, Charlton B, Lafferty KJ: Diabetes results from a late change in the autoimmune response of NOD mice.J Autoimmun10:261–270, 1997 34. Roach T, Slater S, Koval M, White L, Cahir McFarland ED, Okumura M,
Thomas M, Brown E: CD45 regulates Src family member kinase activity associated with macrophage integrin-mediated adhesion.Curr Biol7:408 – 417, 1997
35. Shenoi H, Seavitt J, Zheleznyak A, Thomas ML, Brown EJ: Regulation of integrin-mediated T cell adhesion by the transmembrane protein tyrosine phosphatase CD45.J Immunol162:7120 –7127, 1999
36. Atkinson MA, Leiter EH: The NOD mouse model of type 1 diabetes: as good as it gets?Nat Med5:601– 604, 1999
ISLET TRANSPLANT WITH␣CD45RB AND␣CD154 AB IN NOD