Article
Reference
Structural arrangement and tissue-specific expression of the two murine alpha-amylase loci Amy-1 and Amy-2
SCHIBLER, Ulrich, et al.
SCHIBLER, Ulrich, et al . Structural arrangement and tissue-specific expression of the two murine alpha-amylase loci Amy-1 and Amy-2. Oxford Surveys on Eukaryotic Genes , 1986, vol. 3, p. 210-234
Available at:
http://archive-ouverte.unige.ch/unige:150722
Disclaimer: layout of this document may differ from the published version.
1 / 1
~
7 Structural arrangement and tissue-specific
expression of the two murine alpha-amylase loci Amy- I and Amy-2
UELI SCHIBLER, PHIL H. SHAW,
FELIPE SIERRA, OTTO HAGENBUCHLE, PETER K. WELLAUER, MAURO CARNEIRO, AND ROBIN WALTER
I. Introduction: Alpha-amylase as a model system
During ;inimal development, groups or cells form highly organized tissues, which lake over specialized runctions of the organism. During this process, certain genes become activated in specific cell types, while they slay silent in all remaining cells throughout the liretime or the "organism. Unravelling the molecular mechanisms that govern Lhe regulation or tissue-specific gene expression has been a mong the most challenging tasks for biologists studying multicellular organisms. With the development or recombinant DNA tech- nology such studies have come or age. Individual single-copy genes can be isola ted in pure form and used for the qualitative and qmmtitative analysis of their transcripts. Once the pattern or gene expression has been determined with regard Lo structure, biosynthesis, and accumulation ortranscripts, genes can be mutagcnizcd in vitro and reintroduced into cells or entire organisms.
Such DNA transfer experiments allow the identification of genomic cis- acting elements thnl are required for the correct development and/or tissue- spccific control of gene transcription. In Lurn, this inrormalion will eventually be needed in the search for regulatory tra11.M1cling factors.
We have chosen the mouse alpha-amylase genes as our model system Lo study tiss ue-specific gene expression. Several research groups have investi- gated the biochemistry and genetics of rodent alpha-amylases in depth and have thus set a solid basis for the molecular analysis of alpha-amylase gene expression. These studies have revealed that alpha-amylase isoenzymes arc produced only in the three tissues pancreas, parotid gland, and liver, though al very different rates. Hence this system appears particularly attractive for studies on the cell-type-specific modulation or gene expression.
In this chapter we give an overview of the molecular genetics of murine alpha-amylases, but also include some data Lhul we have recently obtained on the salivary amylase gene of ral. Recently, two review articles have been published that emphasize evolutionary aspects or alpha-amylase genes in many vertebrate species (Meisler and Gumucio l985a, h).To avoid excessive redundancy, the present arlide concentrates on the regulation of alpha- amylase expression in different tissues and during development.
II. Morine alpha-amylases are encoded by two different loci, Amy-1 and Amy-2
Alpha-amylases are major proteins in both saliva and pancreatic juice. The enzymes from these two sources have different mobilities on native protein gels, and classicaJ genetic analysis has revealed that they are encoded by two different loci (Sick and Nielsen 1964; Kaplan et al. 1973). Amy- I and Amy-2 encode salivary and pancreatic alpha-amylases, respectively. Both loci are located on mouse chromosome 3 (Eicher and Lane 1980) and are closely linked since recombination between Amy-I and Amy-2 has never been observed in conventional genetic analysis that attained a resolution ofO. I cM (Hjorth et al. 1980). While most mouse strains contain a single electro- phoretic species for both pancreatic and salivary alpha-amylase, a few strains show more complex pacterns, particularly for pancreatic alpha-amylases.
Thus, pancreatic alpha-amylases from the two laboratory straif)s CE and DE can be resolved into four bands on native polyacrylamide gels (for review see Meisler et al. I983). Recent molecular analysis of the Amy-2 locus in CE- mice suggests that this is even an underestimation. Direct gene-counting experiments revealed a minimum number of 15 Amy-2 copies of which at least five, but probably more, are expressed (Tosi et al. 1984; Bodary et al.
I985).
Thus far no mouse strains have been found that contain more than one electropboretic variant of salivary alpha-amylase (for review see Meisler and Gumucio l 985a). This suggests that, in contrast to Amy-2, Amy-I consists of a single allele. This interpretation is confirmed by molecular gene-counting experiments in strain A/J (Young et al. 1981 ; Schibler et al. 1982) and genetic evidence in strain BXD-16. In this latter strain a spontaneous mutation resulted in an electrophoretic enzyme variant. Mice that are homozygous for this mutation show only the mutant phenotype (Hjorth 1982). There are, however, two mouse strains, YBR and CE, that appear to have two (indis- tinguishable) copies of Amy-I , which have probably arisen by a very recent duplication event. Both of these mouse strains overproduce (approximately twofold) a single electrophoretic variant of salivary alpha-amylase, indicat- ing that both alleles are transcriptionally active (Hjorth 1979; Meisler et al.
1986). Evidence for more extensive Amy-I duplicatjons has been reported for other species, including Chinese hamster (Dawson and Huang 1981 ), bank vole (Nielsen 1969), and man (Pronk et al. 1982).
Thus far three codominant Amy-I alleles have been distinguished within a large variety of mouse strains analysed (Hjorth et al. 1980). Most strains contain the Amy-I a allele, a few bear Amy-I b, and only one strain, C3H- Risskov, contains a third allele, Amy-le.
Alpha-amylase has also been detected in the liver, although at a much lower concentration than in the pancreas or the parotid gland (Arnold and Rutter I963). In both mouse (Takeuchi et al. I975) and rat (Hammerton and
Messer 1971 ), electrophoretic studies suggest that parotid and liver alpha- amylases are identical. This conclusion has been directly confirmed by se- quence analysis of cloned cDNAs (Hagenbi.ichle et al. 1981). The liver enzyme appears to be secreted into the serum (McGeachin er. al. 1962; Arnold and Rutter 1963; Hammerton and Messer 1971 ; Takeuchi er al. 1975). The parotid gland, which, as previously mentioned produces the same isoenzyme is an unlikely source for serum alpha-amylase, since the approximately
IOO-fold increase of salivary gland enzyme during weaning of rats is not paralleled by a similar increase in the blood (Hammerton and Messer 1971).
The molecular mechanism responsible for the differential expression of Amy-I i_n parotid and liver cells of mouse and rat has been revealed from a structural analysis of this gene and will be discussed in detail below.
III. Pancreas, parotid gland, and liver contain alpha-amylase mRNAs with different structures
Complementary DNA sequences have been cloned for alpha-amylase mRNA from pancreas, parotid, and liver (Schible:r et al. 1980; Tosi el a.I. 1981).
Sequencing of these cDNAs in conjunction with direct sequencing of end- labelled mRNAs established the entire primary structure of all these alpha- amylase mRNAs from the 5' terminal cap to the 3' terminal polyA. (Hagen- bi.ichle et al. 1980, 1981). As expected from the protein analysis described in the previous section, liver and parotid alpha-amylase mRNAs share the same coding sequence. In addition, the 3' non-translated region and part of the 5' non-translated region are identical in these two RN As. However, the extreme
?'leader sequences of these transcripts are completely unrelated. The first 47 residues of parotid alpha-amylase mRNA share no homology with the first 162 nucleotides of its liver counterpart. As will be shown below, these two mRNAs are specified by a single Amy-1 allele and are generated by differen- tial splicing ofpre-mRNAs that had been initiated at different start sites.
Pancreatic alpha-amylase mRNA differs in several ways from its parotid gland and liver counterparts. In contrast to these latter mRNA species, it bears a very short 5' non-translated region of only 17 nucleotides. Moreover, its coding region is nine nucleotides shorter than the one of parotid and liver mRNA. Sequence comparison between parotid/liver and pancreatic alpha- amylase mRNA reveals 90 per cent homology. between these sequences (Hagenbi.ichle et al. 1980, 1981). The differences are rather homogeneously distributed along the coding region with the exception of the portion located between residues 450 and 600, which shows accumulation of nucleotide and amino acid changes. Since parotid and pancreatic alpha-amylases have very similar catalytic properties, it appears unlikely that this hypervariable region makes part of the active centre. More fikely, this region allows for greater variability than the remaining sequences without impairing enzyme function.
Sequence data from 24 individual pancreatic alpha-amylase cDNA clones
I
H H·H H
(Hagenbiichle et al. 1985) and direct mRNA sequencing (Hageobiichle et al.
1980) revealed a single species of pancreatic alpha-amylase mRNA in mouse strain A/J. This is surprising in view of the finding that at least two, but prob- ably four, Amy-2 gene copies are expressed in this mouse strain (Hagen- biichle et al. 1985; Pittet and Schibler 1985). The physiological reason for the extraordinary sequence conservation is not evident since, as pointed out above, the significant sequence divergence between pancreatic and parotid alpha-amylases does not interfere with enzymatic function. Therefore, the extensive sequence homology between different Amy-2 alleles in mouse strain A/J either reflects their very recent duplication, or indicates that these genes undergo frequent rectification events that prevent their rapid diversification.
The structural analysis of cytoplasmic alpha-amylase mRNAs revealed several minor species with an extended 3' non-translated region. About 5 per cent ofparotid and liver Amy-I transcripts contain 237 additional 3' terminal nucleotides (Tosi et al. 1981). Within the genomic DNA these extra sequences are located adjacent to the major polyadenylation site. Thus the minor transcripts are generated by utilization of a second downstream poly A addition site. Although different promoters are utilized in parotid gland and liver (see below), the ratio of major and minor transcripts is constant in these two tissues. Thus differential promoter utilization does not influence the fre- quency at which the two polyadenylation sites are used. A minor 3' extended version of pancreatic alpha-amylase mRNA has also been found. This RNA species represents, however, only 0.1 per cent of the major mRNA. The 3' extension comprises about 2000 residues and is thus considerably larger than the coding region itself (Hagenbiichle and Schibler unpublished obser- vation).
Heterogeneity of 5' terminal residues has been found exclusively in liver alpha-amylase mRNA. In this tissue, 25 per cent of Amy-1 transcripts con- tain 33 additional nucleotides. This extra sequence immediately precedes the major cap site in genomic DNA (Young et al. 1981 ).
The structure of the various tissue-specific alpha-amylase mRNAs is sum- marized schematically in Fig. 7.1.
IV. The molecular organization of the two alpha-amylase loci Amy-1 and Amy-2
The cloned cDNAs have been used as probes to identify genomic recombi- nant DNAs bearing alpha-amylase sequences. Initially sequences spanning Amy-1 and Amy-2 were isolated and characterized with regard to transcrip- tional boundaries and exon-intron organization (Schibler et al. 1982). More recently, we performed a chromosomal walk starting from Amy-1 and moving in both 5' and 3' directions.
The structural organization of the Amy-1 and Amy-2 genes is depicted in Fig. 7.2. Both genes are composed of 10 exons that code for the alpha-
5' non- coding coding region 3' non-coding
r egion region
PANCREAS
PAROTID (salivary glond)
LIVER
' ''
' ''
' ''
' l I
~~'''~~~,,~~~~~w-..~,,~~%'%~~~~~~,w-..,,~~~A)n
17 1521. 36
' I 11
I (563-571) 'I : I
98 • ..., < 1 1
e:i:-1 I KA)n
L71 SI: I I I I 1533 33 ,, If
I ' ' ' ' I I
I I I I t
I 156 1511 I I
~ I KA)n
1~3 n
Fig. 7.1 Schematic representation of the major alpha-amylase mRNAs. The lengths of the different mRNA regions are given in nucleotides below the maps. Parotid and liver alpha-amylase mRNAs contain an additional nine nucleotides in comparison with pancreatic alpha-amylase mRNA, coding for three additional amino acids. The positions of these extra residues are shown in parentheses above the parotid mRNA species. The break-point of diversion between parotid and liver mRNA is indicated by a dotted line. The 5' terminal cap structures are shown as solid circles. 5' and 3' non-translated regions are indicated by solid lines. The 3' terminal poly A tail is repre- sented as (A)n. n measures between 50 and 100 residues in alpha-amylase mRNAs as suggested by comparison of these RN As with their deadenylated derivatives (Schibler et al. 1980).
amylase polypeptide. In addition, Amy-I contains two exons that specify 5' non-translated leader sequences. These are separated by 4.9 and 7.8 kb, respectively, from the first coding exon. The most upstream exon specifies the 47 nucleotide leader sequence of parotid alpha-amylase mRNA, while the more downstream exon contains the 162 5' terminal residues associated with liver alpha-amylase mRNA. The mechanism responsible for the generation of two different transcripts from one gene will be discussed below in more detail.
Due to the additional exons and introns, as well as the larger size of several introns, Amy-1 (22 kb) is twice the size of Amy-2 (10.5 kb). As has been observed for other gene systems, the introns are located at homologous posi- tions in Amy-1 and Amy-2. Not unexpectedly, introns diverge at a faster rate than exons (Schibler et al. 1982).
An interesting evolutionary hint was revealed by comparison of the se- quences around the first protein-coding exon of Amy-1 and Amy-2 (Fig. 7.3).
From inspection of these sequences, it is tempting to speculate that during evolution a point mutation occurring within the TATA box of Amy-2 (T-G) has converted this promoter element into a splice acceptor site-. This new splice site was then used in transcripts initiated at fortuitous upstream pro- moters which in a further step acquired a different tissue-specific control (parotid, liver). This speculation appears more likely than the converse, namely that a splice acceptor has been converted into a TAT A motif, since
. ..
Amy-18 , 1 ' r'!' - , ... , "l! .., " ... -'" , Lo'L_5'
""
..
SL 3 ' M SL3' ms''
Amy-2a
pS' p 3'
r s 11) •.6 10 2-!)
I I I I I I I I I I I I I I I I I I I I I I I I
kb
Fig. 7.2 Intron-exon maps of Amy-I and Amy-2. The genomic arrangement of Amy genes was determined from a series of overlapping lambda clones. S5 ' =Amy-I tran- scription initiation site is used exclusively in the parotid gland. Lm 5 ' and LM5 ' =Amy-I minor and major start sites, respectively, used in liver, parotid, and pancreas (see text). P5' = Amy-2 start site used exclusively in the pancreas. SLM3 ' and SLm3 ' =major and minor Amy-I polyadenylation sites used in parotid gland, liver, and pancreas.
P3 ' =major Amy-2 polyadenylation site. Due to its infrequent utilization, the minor Amy-2 polyadenylation site, which is located approximately 2 kb downstream of its major counterpart, is not shown on the map. The cleavage sites of some restriction enzymes are indicated above the maps. The sites provided with asterisks are within exons. B =Barn HI, Bg = Bgl II, H =Hind III, K = Kpn I, P = Pst I, R = EcoRI, S =Sac I. Exons (lower-case letters) and introns (numbered) are shown as solid and open bars, respectively.
Amy-1 a TT TCr:lGARRTRRRTTRGTTGTT RGRRRGRRTRP GCCRRCRGCRTRGCtlRRRTG
•t••••• • • •••••••• •••• •••• • ••••••••••
Amy-2° RRRTr:lTARRTRGGCGC-TRGRGRGRRRGRRCRCTGRCRRCTTCRRRGCRRRRTG +1 - Fig. 7.3 Comparison of Amy-! and Amy-2 sequences upstream of the AUG initia- tion codon. Intron and 5' flanking sequences are written in capital letters. Exon sequences are in bold capital letters. Nucleotide conservations are indicated by aster- isks. The Amy-2 transcription initation site is at position + I. The Amy-2 TAT A motif and the AUG translation initiation codons are underlined. The arrow indicates the T to G conversion which, during diversification of Amy-I and Amy-2, may have generated a splice acceptor site from a TAT A box.
parotid alpha-amylase expression has evolved more recently than pancreatic alpha-amylase expression (Meisler and Gumucio 1985b).
In agreement with genetic evidence, our gene-counting experiments revealed that the haploid genome of mouse strain A contains a single Amy-I copy but multiple Amy-2 copies (Young et al. 1981 ; Schibler et al. 1982;
Hagenbiichle et al. 1985; Pittet and Schibler 1985). Of the four Amy-2 spe-
Chromosome 3
Amy-la
,----,
Amy-2a I<E---43~~2 2 ~23--?<E-ll-X--ll~ <E-ll~ll-)-E-11.;.o. ~32~-E---32---7- 0 is lonce s 1n kb
Fig. 7.4 Amy-I and Amy-2 are closely linked. Amy-I and Amy-2 mRNA coding sequences are depicted as open boxes. The sizes of gene and spacer regions are given below the maps. The organization of the four Amy-2 alleles within the locus is purely hypothetical (see text). Orientation of transcription is indicated by an arrow.
cies, only one can be discriminated from the others by restriction mapping.
This latter gene contains two short deletions of 300 and 100 nucleotides in the most 3' proximal intron, and its 5' flanking region diverges drastically from the other Amy-2 alleles approximately 1 kb upstream of the cap site (Hagen- biichle et al. I985; Pittet and Schibler I 985).
Our chromosomal walk on chromosome 3 of mouse strain A/J directly confirmed the close linkage of the two alpha-amylase loci Amy-I and Amy-2, as previously suggested from classical genetic experiments (Hjorth· ~t al.
1980). Fig. 7.4 shows that these two loci are separated by only 23 kb and that the two linked genes are transcribed in the same orientation. At present, the precise chromosomal arrangement of the four Arny-2 genes with respect to each other is not known, since the extraordinary sequence conservation of both their 5' and 3' flanking regions prevented us from continuing our chromosomal walk. No additional alpha-amylase exons could be detected within 10 kb of either 5' or 3' Amy-2 flanking region, suggesting that the distance between two Amy-2 copies must be at least 20 kb. We feel that the tandem array of the multiple Amy-2 copies shown in Fig. 7.4 is more likely than a more scattered distribution, since the two recent duplication events required to generate four nearly identical genes are likely to result in a head- to-tail orientation of amplified sequences.
Fortuitously, it is the linked copy of Amy-2 that is distinguishable by the two intron deletions from the other three Amy-2 copies (see above). This enabled us to determine by SI nuclease mapping of pre-mRNA whether the former gene is an active allele. The results from such experiments demon- strate that the linked Amy-2 copy and at least one, but possibly all three, of the remaining genes are efficiently transcribed in pancreas cells (Hagenbiichle et al. 1985; Pittet and Schibler I 985).
A close linkage of Amy-I and Amy-2 loci (21 kb) has also been established in mouse strain YBR by Wiebauer et al. (1985). Interestingly, the linked Amy-2 copy of this strain precedes an alpha-amylase pseudogene. Such inactive remnants of alpha-amylase genes have also been observed in mouse strain A/J (Hagenbi.ichle et al. I985; Schibler et al. 1982) and rat (MacDonald et al, 1980; Crerar et al. 1983; Sierra et al. 1986) but thus far they could not be linked to active alpha-amylase genes. One of the pseudo-
genes of strain A/J (termed Amy-X in Schibler et al. 1982 and Hagenbiichle et al. 1985) has a transcriptionally active counterpart in strain YBR, suggest- ing that its transcriptional inactivation occurred rather recently (Gumucio et al. 1985).
An overwhelming complexity of Amy-2 expression has been discovered in the laboratory mouse strain CE. Gene-cloning and gene-counting experi- ments suggest the presence of approximately 15 Amy-2 copies in this strain of which at least five are transcriptionally active (Tosi et al. 1984). Several of these genes bear duplicated promoter regions, located 8 kb upstream of the authentic start site (Bodary et al. 1985). While these orphon promoters are functionally inert, they are of considerable interest with regard to the crea- tion of the upstream Amy-I promoters during evolutionary diversification of alpha-amylase genes (see above).
It can be concluded from the structural considerations on rodent alpha- amylase genes that these are part of a highly dynamic gene family that, dur- ing evolution, has undergone duplication and deletion of entire genes and of small gene segments.
V. The tissue-specific expression of alpha-amylase genes
A. THE MODULATION OF ALPHA-AMYLASE EXPRESSION IN PANCREAS, PAROTID, AND LIVER
The cellular concentration of alpha-amylase mRNAs has been determined in various tissues (Schibler et al. 1980) and the results are listed in Table 7 .1. In pancreas, alpha-amylase mRNA constitutes about 30 per cent ofpolyadeny- lated mRNA and is thus the most abundant gene product. Three parameters contribute to this efficient Amy-2 expression: the simultaneous activity of
Table 7.1
Tissue Active gene Size of mRNAconc. Destination major mRNA mol./cellb of enzyme species•
Pancreas Amy-2c 1577 100 OOO Pancreatic
juice
Parotid gland Amy-le 1659 10000 Saliva
Liver Amy-I 1773 100 Serum
"The given sizes are based on the mRNA sequences (Hagenbiichle et al. 1980, 1981) and do not include 3' terminal poly A.
•The calculation of the approximate number of mRNA molecules per cell is based on the data given by Schibi er et al. (1980).
'The weak Amy- I promoter of Amy-I is also active in this tissue, but does not contribute signifi- cantly to alpha-amylase production.
multiple genes, the strength of Amy-2 promoters, and the high stability of alpha-amylase mRNA (Hagenbiichle et al. 1985; Pittet and Schibler 1985;
Wellauer and Hage.nbiichle unpublished results). Parotid gland acinar cells con lain about 10-fold less alpha-amylase mRNA than do pancreas cells. The difference between these two tissues can be fully accounted for by their differ- ent rates of alpha-amylase gene transcription as measured by run-on tran- scription experiments in isolated nuclei (Hagenbiicble et al. 1985). If one assumes lhat one and four genes are active in parotid and pancreas, respec- tively, then an individual Amy-2 promoter is at least twice as efficient as the Amy- I promoter.
In liver, alpha-amylase mRNA contributes only 0.02 per cent to the mass of cytoplasmic mRNA, corresponding to I/ I OOth and 1/l OOOth of the cellular concentrations found in the parotid and in the pancreas, respectively. Again these differences can be mainly accounted for by different transcription rates of alpha-amylase genes in these tissues (Schibler et al. 1983; Hagenbiichle et al. 1985). Among the many mouse tissues tested (brain, kidney, spleen, gut, skeletal muscle, heart muscle, testis, submaxillary gland, sublingual gland, lacrimal gland, pancreas, parotid, and liver), pancreas, parotid gland, and liver are the only ones containing detectable levels (more than I molecule per cell) of mature cytoplasmic alpha-amylase mRNA. Yet low concentrations of long nuclear Amy-I transcripts, which are not processed into functional mRNA, have been identified in some of the non-producing tissues (Schibler et al. 1983; Sohibler unpublished results). The physiological significance, if there is any, of these apparently sterile transcripts remains obscure.
B. AMY-1 HAS TWO PROMOTERS WITH DIFFERENT TISSUE SPECIFICITY
The finding that the alpha-amylase coding region is fused to different leader sequences in parotid and liver suggested that the single-copy gene Amy-I has different options to manufacture mRNAs. Indeed, the detailed structural analysis of this gene revealed all the sequence elements required for the syn- thesis of parotid and liver alpha-amylase mRNA. In particular, the 47 5' ter- minal nucleoti.des linked to parotid Amy- I transcripts and the 162 nucleotide leader sequence associated with liver alpha-amylase rnRNA have been identi- fied 7.8 kb ~nd 4.9 kb, respectively, upstream of the first common exon (Young et al. I98I). H followed from this arrangement that the parotid and liver alpha-amylase mRNAs are generated by differential splicing of primary transcripts that are initiated at different start sites in the two tissues. The proof for this model was obtained from in vitro elongation of nascent Amy-I transcripts in liver and parotid nuclei. These experiments demonstrated that polymerase II molecules actively engaged in transcription are located only downstream of the two respective start sites. Moreover, they indicated that the upstream parotid-specific promoter (PP) is approximately 30-fold
<E--2.9 kb ') ( 4.9 kb~
F)
AUG- - L L ··---
Strong promoter
... "' ...
Weak promoter
~--- ...
Fig. 7.5 The generalion of two different transcripts from a single Amy- I allele. The Amy- I segment containing the first four exons (black bars) is shown. f n parotid, both the strong upstream promoter and the weak downstream promoter are active. Only the weak promoter is used in liver and pancreas. In the liver, the weak Amy-I pro- moter is the only active alpha-amylase gene promoter. The two different transcripts observed in these tissues arise from the differential splicing of transcripts initiated at either of the two promoters, as depicted in the lower part of the figure.
stronger than the downstream promoter (PL) utilized in hepatocytes (Schibler et al. 1983), thus accounting for most of the difference in abundance ofparo- tid and liver alpha-amylase mRNA. The generation of the two transcripts from Amy-I is schematically shown in Fig. 7.5.
Northern blot analysis with a DNA probe specific for the 162 nucleotide liver leader segment demonstrated that the PL is active not only in the liver but also in the parotid and, surprisingly, in the pancreas. Clearly, mRNA production from this weak promoter cannot be physiologically meaningful in the two latter tissues. Probably, it reflects merely an accessible Amy-I chro- matin structure in parotid gland and pancreas. Indeed, transfection studies (see section E), in which fusion genes bearing PL were introduced into several cell lines that do not express the endogeneous Amy-1 gene, led us to conclude that PL, but not Pp, is rather promiscuous, provided that it is in an accessible chromatin structure (Sierra et al. 1986).
C. THE TWO AMY-1 PROMOTERS PP AND PL ARE ACTIVATED ASYNCHRONOUSLY DURING PAROTID GLAND DIFFER- ENTIATION
Parotid acinar cells proliferate and differentiate mainly after birth (Redman and Sreebny 1971). Accordingly, Hammerton and Messer (1971) have observed that alpha-amylase increases about 100-fold in the saliva during weaning of rats (10 to 20 days of age). This finding prompted us to study the
induction of Amy-1 during postnatal parotid gland differentiation with re- gard to cellular commitment, transcription, and mRNA accumulation (Shaw et al. 1985). In agreement with the results described by Hammerton and Messer (1971), parotid alpha-amylase mRNA increases from hardly detect- able to nearly adult levels in parotids from weaning mice. This increase is mostly accounted for by a corresponding augmentation of transcriptional ac- tivity from Pp. Surprisingly, however, the weak Amy-1 promoter is already utilized soon after birth and at the end of 2 weeks, when few PP and PL tran- scripts are found, has an activity similar to the one observed in adult animals.
More insight into the expression of Amy-1 during parotid differentiation was gained from in situ hybridization experiments which revealed the spatial distribution of Pp transcripts in the parotids of weaning mice. At l week of age, less than 1 per cent of pre-acinar cells contain Pp transcripts. The pro- portion of committed cells then increases and by the age of 3 weeks all acinar cells are strongly positive for this RNA species. Interestingly, the few acinar cells that are positive at early stages of differentiation are not randomly dis- tributed within the gland, but rather are grouped into small clusters. It ,is feasible, therefore, that the differentiated state of dividing committed acinar cells is passed on to the resulting daughter cells. Alternatively, committed cells stimulate their neighbours to induce Pp by intercellular communication.
In agreement with the biochemical analysis of Amy-1 transcripts described above, transcripts initiated at the weak promoter PL are already detected in most acinar cells at the age of 2 weeks, when no more than 20 per cent are accumulating Pp transcripts. Our (speculative) view of Amy-1 activation dur- ing development is shown in Fig. 7.6. In non-expressing cells, including early acinar stem cells, Amy-1 is hidden from the transcriptional machinery by being very tightly packaged into chromatin. In a first phase (birth to 2 weeks) the Amy- I chromatin structure is loosened, resulting in activity from the downstream promoter PL. Finally, the upstream strong promoter is induced by parotid-specific transcription factors that appear only at later stages of differentiation. Interestingly, dexamethasone, a glucocorticoid analogue, in- duces adult alpha-amylase levels prematurely in parotids of preweaning rats (Sasaki et al. 1976; Takeuchi et al. 1977). Since PP is the only active Amy-1 promoter in rat parotid gland (see below), dexamethasone may be directly involved in the regulation of this promoter.
D. TRANSLATION OF PAROTID AND LIVER ALPHA-AMYLASE mRNA
Ribosomes recognize the translational start signals by different mechanisms in pro- and eukaryotes. In bacteria efficient translation requires a strong ribosome binding site, the so-called Shine-Dalgarno sequence, which is com- plementary to the 3' proximal residues of 16 S rRNA (Shine and Dalgarno
1974; Steitz and Jakes 1975). In eukaryotes there is little evidence for a con-
before birth
PL(~
p~~
inactive chromatin
PL8 Pp8
(a)
birth to IOd
active chromatin
PL(±)
Pp8 (b)
IOd to adult
active chromatin + parotid specific transcription factors
PL(±>
Pp(±>
(c)
Fig. 7.6 The activation of Amy-I during mouse parotid gland differentiation. A hypothetical model that takes into account the asynchronous activation of the two Amy-I promoters. In cells that never express Amy-I or in undifferentiated parotid acinar stern cells, Amy-I may be wrapped into non-accessible chromatin (a). Both promoters, PP and PL, are thus hidden from the transcriptional machinery and are therefore inactive. After birth, the Amy-I chromatin may become decondensed in parotid acinar cells, resulting in activity from PL but not from PP (b ). During weaning, this latter promoter may be induced by parotid-specific transcription factors, thus giving rise to the vast majority of alpha-amylase transcripts found in the adult parotid gland. (c).
served sequence around the initiation codon. Instead, another model has been proposed for translation initiation. The ribosome may first bind to the 5' terminal cap structure of mRNA and then scan the sequence in a 5' to 3' direction for AUGs (for review see Kozak 1983). Since liver and parotid alpha-amylase mRNAs have the same coding region linked to leader seg- ments of different sequence and size, it was of interest to determine the rela- tive translation efficiency of these two Amy-1 transcripts. To this end the relative ribosome loading density of the two mRNAs was estimated by hybri- dization with DNA probes complementary to parotid and liver leaders across a polyribosome sucrose gradient. As seen in Fig. 7.7, the two mRNAs show an identical distribution over the polysome profile, indicating that their different leader sequences have little impact, if any, on their polysome load- ing. We believe that the polysome density along these mRNAs is directly pro- portional to the efficiency of translation initiation, since the rate of elongation is unlikely to be different along the identical coding region of par- otid gland and liver alpha-amylase mRNAs.
0.3 00260
0.2
0.1
PAROTID LEADER
LIVER LEADER
+285 +IBS
-
.. ":l . . . .
Fig. 7.7 The translational activities of liver and parotid gland alpha-amylase mRNAs. Polysomes were prepared by combining one parotid gland and one liver in a buffer containing 0.05 M Tris-Cl, pH 7.4, 0.2 M NaCl, 0.02 M MgC12 • The tissues were homogenized in a bounce homogenizer, and the homogenate was spun at 4000 r.p.m.
in a HB-4 rotor for 10 minutes (0°C). The post-nuclear supernatant was made 0.5%
Triton X-100 and 1 % sodium deoxycholate, layered over a linear 15% to 40%
sucrose gradient (made in the homogenization buffer) and centrifuged at 24 K r.p.m.
(
E. THE BEHAVIOUR OF THE AMY-I PROMOTER SEQUENCES Pp AND PL IN TRANSFECTION EXPERIMENTS
To examine the requirements for transcription from Pp and PL, these se- quences were linked to various reporter genes (chloramphenicol acetyl trans- ferase, CAT; beta globin; herpes virus thymidine kinase, TK; simian virus large T antigen; some of the constructs are depicted in Fig. 7.8), and the resulting fusion genes were transfected into cells grown in tissue culture.
Unfortunately, differentiated parotid cells cannot be grown in culture and are thus not available for DNA transfer experiments. Nevertheless, introduc- tion of the fusion genes into cells (mouse L cells, 3T3 cells, 3T6 cells, Hela cells) that do not express their endogenous Amy-I gene revealed some inter- esting features of Amy-1 transcription. The results can be summarized as follows: PL shows significant activity in stably transformed L cells and, in transient expression studies, responds strongly to an SV 40 enhancer se- quence in many cell lines tested. In contrast, Pp, which in parotid cells is at least 30-fold more efficient than PL, is completely silent in all cell lines tested and cannot be activated even by an SV 40 enhancer (Sierra et al. submitted).
It appears, therefore, that Pp is much more stringently controlled in non- expressing tissues than is PL. The more promiscuous behaviour of PL is also evident from its less restricted tissue-specificity and from its activity in poorly differentiated parotid acinar precursor cells (see above).
The observation that PP does not respond to a strong heterologous enhancer suggests that this promoter is repressed by an active mechanism in non-expressing tissues. This speculation prompted us to search for negative sequence elements in the region upstream of Pp. The 5' flanking region of Pr- CA T fusion genes that contain an SV 40 enhancer downstream of the poly- adenylation si~e was progessively deleted and the resulting constructs were tested in transient expression experiments using several fibroblast-deri}led cell lines. Indeed, removal of sequences upstream of position - 300 relieves the transcriptional block (R. Walter unpublished observation), suggesting that the upstream region contains a silencer sequence similar to the one
for 3 hours (0°C) in a Beckman SW-27 rotor. The 00254 of the size-fractionated particles was recorded (solid line), and 13 fractions were collected. RNA was phenol- chloroform extracted from each fraction and chromatographed on oligo dT cellulose to purify polyadenylated RNA (open circles). Aliquots of the polyadenylated RNAs were glyoxylated, fractionated on a l.5% agarose gel and stained with EtBr (the RNAs from gradient fractions 1 to 3 were combined). After transfer to Gene Screen (NEN), the RNA was hybridized successively to nick-translated DNA probes com- plementary to parotid and liver leader sequences. The results show that both Amy-I mRNA species are equally loaded with ribosomes, suggesting that they are equally efficient in initiating protein synthesis. The two abundant liver mRNAs revealed by EtBr staining are most probably major urinary protein mRNA (below 18 S rRNA) and albumin mRNA (just above 18 S rRNA).
A
~A -~pBR322~/j'Bgll Sod
Psll.·Psr sacJ Sau'lA . Sou3A AUG
--- ( I
~ I AMY 1• •PPot \ /.;~·· p'-.lvt"t m,M
\ ,p;·· ,..1M!....
~pBR322
~A ~ E"coR!jtBgtn 0clR1
B
Ppe
E"coRI P'rK Poly AoRl E"coRl
Poly A Ecofll
E"coRI
Fig. 7.8 Amy-I-thymidine kinase fusion genes used in transformation experiments.
Panel a shows the construction schemes used for the generation of hybrid genes con- taining the coding region of the Herpes virus thymidine kinase (TK) gene and Amy-I' PP and PL promoter regions. Panel b shows the promoterless plasmid pTK-0 and its derivatives containing Amy-I promoter segments. The amount of 5' flanking DNA is given in the denomination of each plasmid (e.g. pTK-PL200 contains 200 nucleotides upstream of the weak Amy-I promoter PL).
observed in the non-expressed copies of the yeast mating type loci (Brand et al. I985). Thus far, however, we have not yet examined whether this sequence, when placed into the vicinity of other genes, renders them refractile to activation by enhancers.
F. COMPARISON OF RAT AND MOUSE AMY-I
Recently the genomic DNA segment specifying the 5' moiety of rat Amy-I transcripts has been cloned and characterized (Sierra et al. I986). As has also
been found in its mouse counterpart, this gene contains two promoters in tandem that are differentially active in different tissues. Several interesting differences have, however, been observed between rat and mouse Amy-I. In the rat, Pp and PL are separated by 6 kb as opposed to 2.9 kb in the murine system. The extra 3. l kb intronic segment in rat is a contiguous sequence, suggesting that during rodent evolution it has been inserted or deleted in a single event. The sequences in the vicinity of both Pp and PL are highly con- served between the two species (Fig. 7.9). Unexpectedly, however, different PL start sites are used in mouse and rat despite the close sequence similarity.
In the rat, liver transcripts start heterogeneously in a region located between 160 and 200 nucleotides upstream of the residues corresponding to the major PL cap site in mouse. Moreover, the splice donor site of the rat liver transcript is located downstream of its mouse counterpart. The utilization of different start and splice.sites in rat and mouse results in an mRNA that is about 300 nucleotides longer in the former species. In addition, the more than 400 nucleotide long leader sequence of rat liver alpha-amylase mRNA contains six(!) sterile AUG codons preceding the translational start codon. Neverthe- less, most of this mRNA is associated with polyribosomes in rat liver cyto- plasm (Sierra, unpublished result).
The most surprising difference between mouse and rat Amy- I was dis- covered when the tissue specificity of their tandem promoters was compared.
While Pr is exclusively active in parotid acinar cells in both species, PL is highly liver-specific only in rat. Thus, in contrast to mouse, PL transcripts are not detectable in rat parotids and are present only in minuscule amounts in the pancreas. It will be interesting to test by transfection experiments whether the additional 3 kb of rat intron sequences are implicated in the different tissue specificity of rat and mouse Amy- I expression.
Our cloning experiments yielded a second sequence with strong homology to the rat PL leader that is not (closely) linked to alpha-amylase genes. At least in liver and parotid gland, this orphon leader sequence is not trans- cribed (Sierra et al. I986). It is tempting to speculate from this observation that earlier in evolution PL existed in multiple copies as part of a transposable element. As such it may have invaded Amy- I, providing it with a new pro- moter.
The structure and expression of mouse and rat Amy- I are compared in Fig. 7.10.
G. WHAT IS THE PHYSIOLOGICAL SIGNIFICANCE OF THE WEAK AMY-I PROMOTER?
While the discovery of two promoters with different strengths provided a plausible mechanistic explanation for the different modulation of Amy-I expression in parotid and liver, the physiological signficance of Amy-I activ- ity in the latter tissue remains obscure. As mentioned earlier, liver alpha-
- 558 GAATTCCCTGAGCCGTGACCGGGTGGAATGCTGCCGTGTCATCATTTAGTACTACTTCC
A
mouse lA/Jlttc . • t. tct .. t. cat. tccca ... gatcc .. tgaga .gtgg. c .. ctt .. g. g .. a -499 TTTATGATCTT ATGG AGGAAAGC TAGATGTGTCTG GTATTTTGAA . ggtgcca. a. ctc .. t. tt. cta. t .. t ... atactactgatatc ... . - 454 CAATCCCAAAT AGAATTTTATATTATCATGAATAATTAATCAGTTTGTCTTCTGACTTG
t .... a ... qt ... ta.... . . c .. a . • . at ... et .. . -395 CAGGTGGGTAGATGGTAGCTTGTTTCTTGTTTAAACATGATAT AGGACTGTACTACTTT
tgtaat .g .... a .. a .. ea ... gg .. ttg .•... , . -336 ATTCC TTGTGCCCGTAATGGAGTAGCTCTTTAAAAACTCCCTTTTCCTCAAGTAGAGAA . g .. a . .• . . . t.aa ... .. a . . . a . .. .. ... .. . . . .. .. c.c. • .. a . . -277 CTCAGAGTAGTGCATAACTTGAAAGCTGCTATTTTGTTCAGCATTGAACAACTCATGTCA ....••... ea ... • .. c •. c .•.. . ...•... . g.... gat -217 TAGCACAGCCTGTTCTCCCCAATCTACCTTGTGACTCTGACAGCAGAAGTGCAATGGCTC . .... . . . ... t . . c .. : ... . . .. .. . . g ... . . c .... .. . c .. . -157 TCGGTCCAGAGGAAACACACATTGTTCTTCCTACATGATGCATTACAGAGATTACCGGTT .tt. a ....•... t ..•....•... . ... c •... cg •....•...• a .. g -97 AAAGACTCATGGAAATATATTCCCAACCTAATGGCCAAAAATAAGAACAACTGTTTTTCT -37
... t.tc .... c .. g.t.g .... a .. t •... • .. ~· ... • ...
+I n.:+ n--ti:'
TAGATGAAAATAAAT TGCTCAGGTTAGAGCATGTCATTCTEf'ATCCAAATCAGAA ... et ... . . tgtcc. . . • . . . . . c ·[}.':' ... cgt ... .
exon I i ntron I
+19 GATTCCACCCTCAGTGGGAGGCAGCACAT<J;TATGTAGTC TTAAAGGATATGCTAGTTT ... . . a.tg ... • a ..•...•.•. a .. c .. .. . . ... ... .. .. . +78 GAGTATGGATTTTATGTGCATGTCTTCATGTTATTTTGTCAATGAAACTGAGTTTATTTT . . a . t. c • ... ... ... .. .... c . . . .. c ... aa.c . .. g . a ..
+136 TCACATTACGGCTGCATGTTTGTTGAAATCCATAGATATGTTTGCTTATTGTTAGTGGAA ... t .... t ... t ...•... . .. cc ...•... • ••..
+ 196 GACATTGAGTGTTATTTTGAA . . • .. . ag .. • • .. . . . .. . .
Fig. 7.9 Sequence comparison of Amy- I promoter regions in mouse and rat.
(a) Sequences surrounding Pp. (b) Sequences surrounding PL. Ral genomic sequences are shown and compared with their mouse counterparts and with ral orphon sequences, when available. Dots indicate conservation of a given nucleotide, and spaces are provided Lo allow for best alignment between different sequences. The transcriptional start sites are indicated by arrows. Nucleotide + I in the rat sequences is defined as the most upstream start site detected from each of tbe promoters . .
I \
• BBS GAATTCTGCCAGTGAAAAATTTAGGAATTTGAACAGGAACTACAGAGGCAAGTTTCACCA
B
-825 ACAGAACACAAGGAAAAGCTAGTAAGATTACATTTCAATTTTTAGCATCTGTGCTCCAAA -765 CACACAGCTCAACTAAGTTTATATTTAAAAAAAAACCACAACCACAGCTTAAATCACATA - 705 TTGCCCTTCACACACTGAGAGTGAGGAGGCTATAATGCCACACTCTCATCAATGAACAAG - 6<5 TCATCCAGACAAAGTCTAAACAGACGAAATACTGGAGCTCACAGATATTGTAAACCAAAT - 595 GAGCCTTACAAATATTTATAGGACATTTTTACTGAAATACAAAAGAATATGCTTTCTGCT
- 525 CTCACCTTATGGAAATTTCTCCl\AAA'.lTGACCATGGATACAAAGCAAGCCTCAGTAGGTA
. 1.ss CAAGAGTTTTGAAATCACTCCCTGCACCCTATCTGAAAACCACTTATTGAAGCAACAGAA -1.05 CCAGCAGAAATGTTACAAAGTCATGGAAACTGAATATCTCTCTATTGACTGGAAACTGGG - 3l.S TCAAGACTTTAAAAAAAGAAATGGAGAACTTTTTAGAACCCAGTGAATACACAGCATACC mouse IA/JI •• cq •••••••••••••
- 285 AAAAATTGTGGGACACAATGAAAGTGTTGCTAGGAGGAAAG TTCATAGCACTAAGTGCC c •.• c .• a ••• a •.••• q •••••••• q •• q •• a ••.••••• c ••.•• c ••.•.•.•••.
- 226 TACATAAAATCCCATACTAGCAACTTAAGAGCACACCTGAAAGTTATATAA CAAMCAA ... g •.. g ... t ...•.... t ....•... tg ... . - 167 GAAATTACCCTGAACAGAAAGTAGCAGATGACAAACTCAGACCTAACAGCAGACCTl'TGA
,t ... a •. c ... q ••••• a ... t .... g ••••••••• t.at ... . - 107 TTCAGTGMTCTGTTCCCATTATAGTCTCATTTATTTTATTGATTCAAGTTTGGCTCAAT
.. a ... t ... g ... g ..
+!,.
-I. 7 GATAAACTAGTGTGACCTTTAAACTTATTCTGCCAGACTTTTACCccYTATTGTATATC ... a ... t ... t. a.a .. c. c ... a
~ nt"~ ....
+ I L ~~:~~ • ::;~~~~~¥.-~::~~~~:~~~~~~~~~~~:~:~:~:~~~~~~:~~~~:~
mouse Lm +11. GTGAATTGTGCTGTAATAGAGGTGGTGATAGCAGCAGC GGAGGGAAGGCAGTGGCTTC
a ... a .. t .. c ... a ... t ... a ... acca ...•... , ·GSi.· ..
rat orphon •••• g .•.. a ... ata .. gtatgca et ... a ... t mouse LH
+ 132 TAAGG ACACGAGGGTGAGGATGCCCGGTCCATCATAGGTCACCGTGGAGCTCAGATCAC
~::~:a:'. :t~gt:: :t:~:~:::: :~~·
· ·
:~:::::: :~::::::::·:: ·::::
+ 191 AGTGCTGACAGAATGCATATTTGGAGAATTACATAAGATTTGAAAGAGAGA ATAGTGA ... c ... g .••..•.•••.. g ••...
c ... , .... t, ...•... t ... g ....•... g.c.a .. . +250 AAGGAAACAACTTTATAAATTTC TAATCAGGCCTTTTGTTTGAACTGAA GAGTAGTT ... t .. g.a .. cc . . .. aag.tt ... t .. , ... a ... a. a ..
. . a .. tgag. taa ...•.... ea ... aattctaatctttttqcacaacaaaagtttat
mou~ spl ice
· 307 ~~~~:~~~~:::~~:~~::::~~~:~~~~~:~~~~~~:::
ctcc'tgctaat&~ecccata;,;ca9g9ta.tta9tattctctotq-tu.t.cataacca9t.ca
e)(on I intron I
+367 GGATGGTTGCTGGTTGATACAAGTTGAT<J;TAAGTTACTCTTAAATTATGTTTGTCTGTT ... t .. a •• t
gaaacttagcctccttaacatggcttttaccaaacatatttgt9tttcttccaaccgtga +J.87 TGTTTTTACTTTCCTCCCGTTTTGTACTTAATTAGAGATTTATTTTTATTTCTTTATGGG
gatagaattgcatctcctttgaagttacatgaagaa TTGATC
PANCREAS LIVER
( ffi~---· ) 1111---+
PAR OT ID
c:::::::;::>
Pp PL A~
RAT--j]
D
... _
~t ~MOUSE
····u 0 Q---
Pp PL AUG
PAR OHO ~ If---+
LIVER If---+
PANCREAS If---+
Fig. 7. I 0 Comparison of Amy- I expression in mouse and rat. The corresponding rat and mouse genomic fragments are compared. The relative expression of the pro- moters in different tissues is indicated above the maps for rat and below the maps for mouse. The thickness of the arrows reflects the relative strength of the promoters.
amylase is secreted into the serum long before significant levels of parotid alpha-amylase appear in the saliva (Hammerton and Messer 1971). Yet it is not expected that the blood contains the alpha-amylase substrates (starch and glycogen) in massive amounts. It is therefore relevant to ask whether the serum alpha-amylase has a purpose other than digesting high molecular weight carbohydrates. One attractive speculation concerning its physio- logical role relates to its involvement in establishing immunotolerance against the abundant parotid alpha-amylase. We have pointed out in a pre- vious section that this enzyme and its mRNA increase from barely detectable to adult levels between 2 and 3 weeks after·birth. At this time the immune sys- tem has already concluded the self-non-self discrimination. Thus parotid alpha-amylase should be recognized as a foreign protein and, as such, pro- voke an autoimmune response. This may be prevented by the early appear- ance of an identical protein in the serum, leaving a 'self-imprint' in the memory of the immune system.
H. THE DEVELOPMENT AL EXPRESSION OF AMY-2 GENES The pancreas develops much earlier than the parotid gland in rodents. In the rat embryo, its anlage is already detectable before day 12, and after 20 days in utero most pancreatic secretory proteins are already produced in large amounts (Han and Rutter 1986). The mechanism postulated above for estab- lishment of immunotolerance against parotid alpha-amylase would thus be irrelevant for pancreatic enzymes.
The expression of Amy-2 is under the direct or indirect control of at least two hormones. Both insulin (Korc et al. 1981) and corticosteroids (Sasaki et al. 1976; Takeuchi et al. 1977) have been shown to be required for maximum
Amy-2 activity. An interesting observation has been made by the group of M. Meisler concerning regulation of pancreatic alpha-amylase synthesis by insulin in mouse strain YBR. This strain contains two electrophoretic vari- ants of pancreatic alpha-amylase. Upon chemical induction of diabetes, one Amy-2 allele becomes repressed, while the other continues to produce the enzyme (Dranginis et al. 1984). This suggests that during evolution this latter allele may have lost cis-acting sequences involved in the positive response to insulin.
Recently, it has been shown by transfection experiments into pancreatic, hepatoma, and fibroblast cell lines that regulatory sequences required for both tissue-specific expression and response to glucocorticoids reside within the immediate 5' flanking region of Amy-2 genes (Hagenbiichle, Hurst, and Wellauer in preparation). It is not surprising, therefore, that this sequence is extremely well conserved between different Amy-2 copies. As a matter of fact, only a single nucleotide change was observed within the 320 nucleotides preceding the cap sites of the Amy-2 copy linked to Amy-1 and another Amy-2 member (Hagenbiichle et al. 1985). Between positions - 320 and - 400 the two Amy-2 alleles diverge by 11 per cent in nucleotide sequence and beyond - 1 kb any recognizable sequence homology is lost between these two Amy-2 alleles (Wellauer and Hagenbiichle unpublished results).
I. TERMINATION OF ALPHA-AMYLASE GENE TRANSCRIPTION It has been shown for the beta globin gene, the ovalbumin gene, and several viral genes that transcription termination occurs downstream of the poly- adenylation site (for review see Birnstiel et al. 1985). The tandem arrange- ment of Amy-1 and Amy-2 genes prompted us to determine the regions of transcription termination in these two genes. Since cleavage and polyadeny- lation occur very rapidly, and since the portions transcribed downstream of the poly A addition site are exceedingly unstable, termination must be studied by using techniques which do not depend on RNA turnover. We used run-on ( transcription in isolated nuclei to locate the sites of termination in Amy-1
(Pittet and Schibler 1985) and Amy-2 (Hagenbiichle et al. 1984). While most RNA polymerase II molecules terminate Amy-1 transcription immediately downstream of the polyA site (within 400 nucleotides), they continue to tran- scribe Amy-2 DNA stochiometrically at least 2 kb downstream of the major polyadenylation site before they terminate heterogeneously in the following 2 kb segment. Thus far it is not clear whether termination is signalled by spe- cific sequence elements or by particular chromatin structures. Our results on transcription termination are schematically illustrated in Fig. 7.11 .
VI. Concluding remarks
The tissue-specific expession of the two murine alpha-amylase loci Amy-I
+
PPorotid AMV-1 a
1---
- - -- IL __
PPoncreos AMV-20
~~-1==---~_:~=== +
Fig. 7.11 Transcription termination in mouse Amy-I and Amy-2 genes. Major and minor poly A sites are indicated by large and small arrows, respectively. Most Amy- I transcripts are terminated close to the poly A sites. A few transcripts extend as much as 3 kb downstream of this si te. Transcription termination is identical in parotid and liver, suggesting that it does not depend on the choice of the promoter. Virtually all Amy-2 transcripts extend at least 2 kb downstream of Lhe major poly A site and are terminated at multiple positions between 2 kb and 4 kb downstream of this site.
and Amy-2 is summarized in Fig. 7.12. Our results concerning the structure and expression of alpha-amylase genes document that they are part of a very dynamic gene family. During evolution, multiple gene copies have arisen through duplication and diversification of a common ancestral gene, prob- ably active only in the pancreas of vertebrates (Meisler and Gumucio 1985b).
Some of the copies may have acquired different tissue specificities by several mechanisms, including point mutations, promoter insertions via trans- posable elements and/or promoter duplication, and diversification of the duplicated control element. Other gene copies have suffered modifications that inactivated them. The multiple pseudogenes observed in several mouse strains (see above) as well as in rats (MacDonald et al. 1980) are remnants of such genes.
Modulation of alpha-amylase expression is regulated mainly by two mechanisms in the three tissues that produce this enzyme: differential strength of tissue-specific promoters and, in the pancreas, which is the most active alpha-amylase producer, the utilization of multiple gene copies (gene dosage). Since transcription rates can largely account for the differential accumulation of alpha-amylase mRNAs in the three expressing tissues, we consider it unlikely that these transcripts vary significantly in stability.
Transcription from the two Amy-I promoters is not only tissue specific but also stage specific during parotid gland differentiation. All the expression studies reported in this paper are consistent with the speculation that the weak promoter, PL, is much less stringently controlled than the parotid-
'
'l : ' I I '
Amy-la
Parotid
H==>
i :--
I
I
Liver
!
~' I I '
' t t t t '
Pancreas : 1----+
' t
,---- Amy-2a
,~b-
~ ~
i:::::=:::>
~Fig. 7.12 Summary of transcription ofmurine Amy-1 and Amy-2 genes. The Amy-1 and Amy-2 transcripts observed in the different alpha-amylase-expressing tissues are shown by arrows. The varying thickness of the arrows reflects differenL promoter strengths. All four Amy-2 aJ1eles of mouse strain A/J are assumed to be transcrip- tional'ly active although tbjs has only be rigorously shown for two gene copies (see text).
specific strong promoter Pp. Actually, it appears quite likely that the activity of the former promoter merely reflects a transcriptionally permissive chro- matin structure of Amy- I. In this context it is interesting to note that Amy- I is in an accessible chromatin domain in the pancreas. Is the converse true for Amy-2 in parotid and/or liver? Recent chromatin studies aimed at answering this question have shown that, in these two tissues, Amy-2 chromatin is equally as resistant to digestion with DNAase I as it is in spleen, which does not express either of the two alpha-amylase loci (Schibler and Pittet, unpub- lished observation). One may argue, therefore, that sequences located within the Amy-I locus are required for opening the chromatin of both loci."1f cor- rect, this hypothesis would imply that during differentiation of all alpha- amylase-expressing tissues, the alpha-amylase chromatin starts opening at identical sequences but closes downstream of Amy- I in parotid and liver, and downstream of the Amy-2 complex in the pancreas. According to this model, the activation of Amy-2 during pancreatic development may require far upstream Amy-I sequences. It will be very exciting to test this hypothesis in transgenic mice.
Acknowledgements
We are grateful to A.-C. Pittet and R. Bovey for excellent technical assist- ance. P. H. S. acknowledges an NIH postdoctoral fellowship and M. C. a predoctoral fellowship from the Brazilian Research Council CNPq.
We thank K. Gorski for reading the manuscript. These studies were sup- ported by grants from the Swiss National Science foundation to U. S., P. KW. and 0 . H.
References
Arnold, M. and Rutter, W. J. (1963). Liver amylase: Synthesis by the perfused liver and secretion into the perfusion medium. J. Biol. Chem. 238, 2760--2765.
Birnstiel, M. L., Busslinger, M., and Strub, K. (1985). Transcription termination and 3' processing: The end is in site. Cell 41, 349-359.
Bodary, S., Grossi, G., Hagenbiichle, 0., and Wellauer, P. K. (1985). Members of the Amy-2 alpha-amylase family of mouse strain CE/J contain duplicated 5'-termini.
J. Mo!. Biol. 182, 1-10.
Brand, A. H., Breeden, L., Abraham, J., Sternglanz, R., and Nasmyth, K. (1985).
Characterization of a 'silencer' in yeast: A DNA sequence with properties opposite to those of a transcriptional enhancer. Cell 41 , 41-48.
Crerar, M. M., Swain, W. F., Pictet, R. L., Nikovits, W., and Rutter, W. J. (1983).
Isolation and characterization of a rat amylase gene family. J. Biol. Chem. 258, 1311-1317.
Dawson, W. D. and Huang, L. L. (1981). Comparative genetics of hamster amylases.
Biochem. Genet. 19, 623-633.
Dranginis, A., Morley, M., Nosbitt, M., Rosenblum, B. B., and Meisler, M. H.
(1984). Independent regulation of nonallelic pancreatic amylase genes in diabetic mice. J. Biol. Chem. 259, 12216-12219.
Eicher, E. M. and Lane, P. W. (1980). Assignment of linkage group XVI to chromo- some 3 in the mouse. J. Hered. 71, 315-318.
Gumucio, D. L., Wiebauer, K., Dranginis, A., Samuelson, L. C., Treisman, L. 0., Caldwell, R. M., Antonnucci, T. K., and Meisler, M. H. (1985). Evolution of the amylase multigene family: YBR/Ki mice express a pancreatic gene which is silent in other strains. J. Biol. Chem. 260, 13483-13489.
Hagenbiichle, 0., Bovey, R., and Young, R. A. (1980). Tissue-specific expression of mouse alpha-amylase genes: Nucleotide sequence of isoenzyme mRNAs from pan- creas and salivary gland. Ce/l 21, 179-187.
- - Tosi, M., Schibler, U., Bovey, R., Wellauer, P. K., and Young, R. A. (1981).
Mouse liver and salivary gland alpha-amylase mRNAs differ only in 5' nontrans- lated sequences. Nature 289, 643-646.
Hagenbiichle, 0., Wellauer, P. K., Cribbs, D. L., and Schibler, U. (1984). Termina- tion of transcription in the mouse-amylase gene Amy-29 occurs at multiple sites downstream of the polyadenylation site. Ce/l 38, 737-744.
- - Schibler, U., Petrucco, S., Van Tuyle, G. C., and Wellauer, P. K. (1985).
Expression of mouse Amy-2 alpha-amylase genes is regulated by strong pancreas- specific promoters. J. Mo!. Biol. 185, 285-293.
Hammerton, K. and Messer, M. (1971). The origi·n of serum amylase. Electrophoretic studies of isoamylases of the serum, liver and other tissues of adult and infant rats.
Biochem. Biophys. Acta 244, 441-451.
Han, J. H. and Rutter, W. J. (1986). Selective expression of rat pancreatic genes during embryonic development. Proc. Natl. Acad. Sci. USA 83, 110--114.
Hjorth, J. P. (1979). Genetic variation in mouse salivary amylase rate of synthesis.
Biochem. Genet. 17, 665-682.
- - (1982). Altered salivary amylase gene in the mouse strain BXD-16. Heredity 48, 127-135.
- - Lusis, A. J., and Nielsen, J. T. (1980). Multiple structural genes for mouse amy- lase. Genetics 18, 281.
Kaplan, R. D., Chapman, V., and Ruddle, F. H. (1973). Electrophoretic variation of alpha-amylase in two inbred strains of mus musculus. J. Hered. 64, 155-157.
Korc, M., Owerbach, D., Quinto, C., and Rutter, W. J. (1981). Pancreatic islets-
