IS THE OCTOMACRIDAE THE SISTER FAMILY OF THE DlPLOZOIDAE ?
S I C A R D M.*, D E S M A R A I S E.* & L A M B E R T A.*
Summary :
Diplozoidae and Octomacridae are usually considered as sister families. Essentially this is because they are the only
polyopisthocotyleans parasitising primary freshwater teleosts.
Because of the lack of phylogenetically informative morphological characters to explore the pattern of colonisation of the primary continental freshwater teleosts and in order to understand the appearance of the "natural parabiosis" of Diplozoidae, a molecular phylogeny was inferred by comparing newly obtained partial 2 8 S and 1 8 S rDNA gene sequences of Eudiplozoon nipponicum and Diplozoon komoion with other already available sequences. The phylogenetic analysis seems to show that Diplozoidae and Octomacridae are not sister groups. Thus, the colonisation of primary freshwater teleosts by these two families could be independent.
KEY WORDS : Diplozoidae, Octomacridae, Cyprinidae, Catostomidae, freshwater fishes, molecular phylogeny.
Résumé : LES OCTOMACRIDAE CONSTITUENT-ILS LE GROUPE FRÈRE DES DlPLOZOIDAE ?
Les Diplozoidae et les Octomacridae sont décrits dans l'ensemble des classifications actuelles des Polyopisthocorylea comme étant des groupes frères. Cela est essentiellement dû au fait qu'ils sont les seuls Polyopisthocorylea parasitant des poissons d'eaux douces primaires. Les données morphologiques et ultrastructurales qui réunissent ces deux familles sont peu nombreuses et discutables.
Pour explorer le mode de colonisation des poissons d'eaux douces primaires et pour mieux comprendre l'apparition de la parabiose naturelle des Diplozoidae, nous avons réalisé des séquences partielles de 18S et 28S ADNr pour deux espèces de
Diplozoidae : Eudiplozoon nipponicum et Diplozoon homoion que nous avons intégré dans une phylogénie moléculaire avec les séquences déjà disponibles. L'étude de la relation entre Diplozoidae et Octomacridae semble montrer qu'ils ne sont pas monophylétiques, ce qui sous-entend que la colonisation des poissons d'eaux douces primaires par ces deux familles pourrait avoir eu lieu indépendamment.
MOTS CLES : Diplozoidae, Octomacridae, Cyprinidae, Cotostomidae, poissons d'eau douce, phylogénie moléculaire.
P
o l y o p i s t h o c o t y l e a n s r e a c h their greatest diversi- fication mainly o n marine teleost fishes. Never- theless, in this subclass, the D i p l o z o i d a e and O c t o m a c r i d a e are the only families parasitising primary freshwater teleosts. T h e D i p l o z o i d a e with m o r e o f 5 0 s p e c i e s actually d e s c r i b e d are really diversified o n Cyprinidae and Characidae, the O c t o m a c r i d a e with only five species described on Catostomidae and Cypri- nidae are less diversified ( K h o t h e n o v s k y , 1 9 8 5 ) . T h e s e two parasite families along with the D i s c o c o t y - lidae constitute the suborder Discocotylinea ( B o e g e r &Kritsky, 1 9 9 3 ; Lebedev, 1 9 9 5 ; B o e g e r & Kritsky, 1997;
B o e g e r & Kritsky, 2 0 0 1 ) . T h e few m o r p h o l o g i c a l c h a - racters in favour o f the grouping o f t h e s e three fami- lies in this suborder are not very strong and this deci- sion is debatable. B o e g e r & Kritsky ( 1 9 9 3 ) claimed that t w o m o r p h o l o g i c a l characters support the m o n o p h y l y
* Laboratoire Génome, Populations, Interactions, c.c.105, CNRS UMR 5000, Université de Montpellier II, Place F.ugène Bataillon, 34095 Montpellier Cedex 05, France.
Correspondence: Mathieu Sicard.
Tel : 33 (0)4 67 14 36 92 - Fax : 33 (0)4 67 14 46 46.
E-mail: [email protected]
o f the Discocotylinea, n a m e l y the a b s e n c e o f spines o n the m a l e copulatory organ and the a b s e n c e o f a n c h o r s at all stages o f d e v e l o p m e n t . But a p h y l o g e - netic analysis b a s e d o n partial D 2 s e q u e n c e s o f 28S rDNA s h o w e d that m o n o p h y l y o f the D i s c o c o t y l i n e a is q u e s t i o n a b l e b e c a u s e the D i s c o c o t y l i d a e a p p e a r e d to b e only distantly related to the Diplozoidae (Jovelin
& Justine, 2 0 0 1 ) . A d i v e r g e n c e o f the D i s c o c o t y l i d a e is likely since they are essentially parasites o f Salmo- nidae. This fish family contains m a n y a n a d r o m o u s fishes and is not a primary freshwater family, unlike the Cyprinidae, Characidae and Catostomidae. O n this basis, K h o t h e n o v s k y ( 1 9 8 5 ) has p r o p o s e d the asso- ciation o f Diplozoidae and Octomacridae in a suborder, the O c t o m a c r i n e a . S i n c e D i p l o z o i d a e and O c t o m a - cridae are the only polyopisthocotyleans diversified o n continental freshwater fishes, it is possible that they have diverged from a recent c o m m o n a n c e s t o r already present o n freshwater teleosts.
T h e present-day diversity is thus the result o f c o - s p e - ciation a n d switch b e t w e e n fishes and parasites, the freshwater habitat being a simple shared phylogenetic character ( s y n a p o m o r p h y ) . So, a detailed examination
Parasite, 2002, 9, 85-87
Note de recherche 8 5
Article available athttp://www.parasite-journal.orgorhttp://dx.doi.org/10.1051/parasite/200209185
o f their phylogenetic relationship could reveal whether the colonisation o f primary freshwater teleosts by poly- p i s t h o c o t y l e a n s t o o k p l a c e o n c e b y their c o m m o n a n c e s t o r or several times in i n d e p e n d e n t events o f colonisation.
T h e exploration o f the p h y l o g e n e t i c relationship bet
w e e n these two families c o u l d also provide us with the opportunity to address another intriguing question:
t h e D i p l o z o i d a e exhibits o n e o f the m o s t striking m o d e s o f reproduction (Lambert et al, 1 9 8 7 ) . Indeed, the hermaphrodite adults d e v e l o p and reach sexual maturity only after the permanent fusion o f two larvae.
If a family c l o s e to the Diplozoidae c o u l d b e found, it may s h e d light o n the origin o f this intriguing sexual graft. T h e O c t o m a c r i d a e s e e m s to b e the m o s t likely candidate, but very few morphological arguments sup
port this hypothesis. T h e genitalia are absent in the D i p l o z o i d a e due to the sexual graft. S o , the only mor
p h o l o g i c a l c h a r a c t e r s u p p o r t i n g this p h y l o g e n e t i c proximity, is the p r e s e n c e o f only o n e testis in the her
maphrodite individuals o f the two families. A study o f the spermatozoid ultrastructure (Hathaway et al, 1 9 9 5 ) u n d e r t a k e n to e x p l o r e this p h y l o g e n e t i c relationship failed to s h o w any c o m m o n characters b e t w e e n the two families. But this result is due to the aflagellate structure o f the spermatozoid o f the Diplozoidae, a characteristic and specific trait o f this family (Justine et al, 1985; Justine, 1 9 9 1 ) .
A m o l e c u l a r investigation was necessary to o v e r c o m e this lack o f phylogenetically informative morphological characters and to elucidate the colonisation pattern and the evolution o f the reproductive system.
MATERIALS AND METHODS
that are tetrapod parasites. M a z o c r a e i d a e divergent from other teleost's parasites (Mollaret et al, 2 0 0 0 ) w e r e c h o s e n in order to evaluate the phylogenetic dis
tance b e t w e e n the others families: Axinidae, M i c r o c o - tylidae, D i p l o z o i d a e and O c t o m a c r i d a e that are c l o s e d in the cladistic m o r p h o l o g i c a l analysis ( B o e g e r &
Kritsky, 1 9 9 3 ) .
The DNA o f members o f the Diplozoidae was obtained with a CTAB buffer and amplified as previously described by Sicard et al. (2001). T h e 28S rDNA was amplified with the primers cer58S2249: 5GCTCACGTGACGATGAAGAG3 and c e r 2 8 S 3 H 6 : 'TCGCTATCGGACTCGTGCC3', the 18S rDNA with the primer c e r l 8 S 3 8 6 : 5 AACGGCTACCACAT- C C A A G G3 and reverse primer c e r l 8 S 1 5 8 5 : 5G C A G G - GACGTATTCAGCACA3 (the n u m b e r s in the n a m e o f the primer refer to the n u m b e r position in the Coe- norhabditis elegans s e q u e n c e s ) . PCR products w e r e purified with the G e n e c l e a n kit ( B i o 1 0 1 ) and s e q u e n c e d with t h e s a m e p r i m e r s as for PCR w i t h t h e T h e r m o S e q u e n a s e kit ( A p b i o t e c h ) . T h e e l e c t r o p h o resis w a s performed in an ALFred ( A p b i o t e c h ) auto
matic s e q u e n c e r . T h e s e q u e n c e s w e r e first aligned automatically o n the Multalin server (Corpet, 1 9 8 8 ) (www.toulouse.inra.fr/multalin) and manually revised using the Software G e n e d o c ( w w w . p s c . e d u . b i o m e d / genedoc). T h e partial s e q u e n c e o f 18S rDNA and par
tial s e q u e n c e o f 28S rDNA (full domain C I , full D l and partial D 2 ) w e r e used. T h e phylogenetic analyses w e r e performed b y Phylowin (Galtier et al, 1 9 9 6 ) . T r e e s w e r e c o n s t r u c t e d w i t h t h e b i o - N e i g h b o u r - j o i n i n g ( b i o N j ) , t h e m a x i m u m l i k e l i h o o d ( M L ) a n d t h e m a x i m u m parsimony (MP) methods. B o o s t r a p values w e r e calculated for bioNJ, ML and MP with 5 0 0 repli
cates and likelihood o f the t o p o l o g i e s was tested with Phylowin.
W
e s e q u e n c e d 6 4 0 p b o f the 3' e n d o f the 18S rDNA and 2 5 0 p b o f the 5' e n d o f the 28S rDNA region D l o f two Diplozoidae: Diplo- zoon homoion from Rutilus rutilus and Eudiplozoon nipponicum from Cyprinus carpio collected in southern France. T h o s e two partial s e q u e n c e s correspond to the molecular information already available for the O c t o macridae and other Polyopistocotylea (Littlewood et al, 1998; Littlewood et al, 1 9 9 9 ; Mollaret et al, 1997;Mollaret et al, 2 0 0 0 ) . This molecular information is available in G e n b a n k data b a s e for: Octomacrum lan- ceatum ( O c t o m a c r i d a e ) parasitising Catostomus cato- stomus, O. mexicanum ( O c t o m a c r i d a e ) parasitising Catostomus sp., Neopolystoma spratti (Polystomatidae) parasitising Chelodina longicollis; Zeuxapta seriolae (Axinidae) parasitising Seriola hippos; Bivagina pagro- somi (Microcotylidae) parasitising Chrysophrys aurata;
Kuhnia scombri ( M a z o c r a e i d a e ) parasitising Scomber scombrus. T h e tree was rooted with Polystomatidae
RESULTS AND DISCUSSION
W
h e n w e c o m p i l e d the 18S rDNA and the 28S rDNA in the s a m e p h y l o g e n e t i c analysis, w e obtain the most strongly supported topology (Fig. 1 ) . T h e relative rate o f evolution o f internal b r a n c h e s w a s estimated with RRTree ( R o b i n s o n et al, 1 9 9 8 ) to detect a potential "long-branch" effect. In our analysis o f the tree, only the M a z o c r a e i d a e s h o w s a significantly faster evolutionary rate c o m p a r e d to the other polyopisthocotyleans using Neopolystoma as refe
r e n c e . This p r o b a b l y explains w h y the values o f the b o o t s t r a p o f the b r a n c h b e t w e e n Kuhnia and the others are so low.
T h e p h y l o g e n e t i c tree o b t a i n e d modulates the idea o f c l o s e p h y l o g e n e t i c relationship b e t w e e n D i p l o z o i d a e and O c t o m a c r i d a e , and at the s a m e time the m o n o - phyly o f the D i s c o c o t y l i n e a o b t a i n e d from m o r p h o l o -
SICARD M., DESMARAIS E. & LAMBERT A.
86 Note de recherche Parasite, 2002, 9, 85-87
OCTOMACRLDAE AND DIPLOZOIDAE
Fig. 1. - Molecular Phylogenetic relationship between Diplozoidae, Octomacridae and other teleost's Polyopisthocotylea inferred from partial 18S rDNA sequences and partial 28S rDNA sequences.
We have compiled the 18S rDNA and the 28S rDNA sequences in the same phylogenetic analysis and we obtained a most strongly sup
ported topology than the separate analysis. Numbers on branching are the bootstrap proportion calculated with 500 iterations respec
tively with bio neighbour-joining method, MP and ML. The likeli
hood for other imposed topology was tested with Phylowin and this tree still the best one. The relative rate o f evolution of internal branches was estimated with RRTree to detect a potential "long- branch" effect. Only the Mazocraeidae show a significantly faster evo
lutionary rate compared to the other Polyopisthocotyleans using Neo- polystoma as reference.
gical analysis ( B o e g e r & Kritsky, 1 9 9 3 ; Lebedev, 1 9 9 5 ; B o e g e r & Kritsky, 1997; B o e g e r & Kritsky, 2 0 0 1 ) . In fact, the D i p l o z o i d a e s e e m s to b e t h e sister group o f a clade including Microcotylidae, Axinidae ( M i c r o c o - tylinea) a n d O c t o m a c r i d a e . T h u s , this p h y l o g e n e t i c tree suggests that there is n o recent c o m m o n a n c e s t o r for D i p l o z o i d a e a n d O c t o m a c r i d a e . O n the contrary, the t o p o l o g y as well as t h e relative b r a n c h length sug
gests t h e e x i s t e n c e o f other taxa that might b r a n c h s o m e w h e r e b e t w e e n Mazocraeidae a n d Diplozoidae.
In conclusion, it s e e m s that O c t o m a c r i d a e is not the right candidate for studying t h e origin o f the special traits o f t h e Diplozoidae. Concerning the colonisation o f t h e primary freshwater teleosts, t h e paraphyly o f D i p l o z o i d a e a n d O c t o m a c r i d a e suggests that it c o u l d result o f t w o different events.
REFERENCES
BOEGER W. & KRITSKY D. Phylogeny and a revised classifica
tion of Monogenoidea Bychowsky, 1937 (Platyhelminthes).
Systematic Parasitology , 1993, 26, 1-32.
BOEGER W. & KRITSKY D. Coevolution of the Monogenoidea (Platyhelminthes) Based on a Revised Hypothesis of Para
site Phylogeny. International Journal for Parasitology, 1997, 27, 1495-1511.
BOEGER W. & KRITSKY D. Phylogenetic relationships of the Monogenoidea. In: Littlewood D . T J . & Bray R.A. (Eds.), Interrelationships of the Platyhelminthes. Taylor and Francis, London, 2001.
CORPET F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research, 1988, 16, 10881-10890.
GALTIER N , GOUY M. & GAUTIER C. Seaview and Phylowin:
two graphic tools for sequence alignment and molecular phylogeny. Cabios, 1996, 12, 543-548.
HATHAWAY M., HATHAWAY R. & KRITSKY D. Spermatogenesis in Octomacrum lanceolatum (Monogenoidea, Oligon- choinea, Mazocraeidea). International Journal for Parasi
tology, 1995, 25, 913-922.
JOVELIN R. & JUSTINE J.L. Phylogenetic relationships within the polyopisthocotylean monogeneans (Platyhelminthes) inferred from partial 28S rDNA sequences. International Journal for Parasitology, 2001, 4, 393-401.
JUSTINE J.L. Cladistic study in the Monogenea (Platyhel
minthes), based upon a parsimony analysis o f spermio- genetic and spermatozoal ultrastructural characters. Inter
national Journal for Parasitology, 1991, 21, 821-838.
JUSTINE J.L., LE BRUN N. & MATTEI X . The aflagellate sperma
tozoon of Diplozoon (Platyhelminthes: Monogenea: Poly
opisthocotylea): a demonstrative case of relationship bet
ween sperm ultrastructure and biology of reproduction.
Journal of ultrastructure research, 1985, 92, 47-54.
KHOTHENOVSKY I. Suborder Octomacrinea Khotenovsky. Fauna of the URSS Monogenea, Akad. Nauk. Leningrad, 1985, 132-262.
LAMBERT A., LE BRUN N. & RENAUD F. L'étrange reproduction d'un ver parasite. La Recherche, 1987, 18, 1548-1551.
LEBEDEV B. Biodiversity and evolution of the Oligonchoinean Monogenoidea. Institute of Biology and Pedology, The Russian Academy of Sciences, Far East branch, Vladi
vostok, 1995.
LITTLEWOOD T., ROHDF. K., BRAY A. & HERNTOU E. Phylogeny of the Platyhelminthes and the evolution of parasitism. Bio
logical Journal of the Linnean Society, 1999, 68, 257-287.
LITTLEWOOD T., ROHDE K. & CLOUGH K. The phylogenetic posi
tion of Udonella Udonella (Plathyhelminthes). Interna
tional Journal for Parasitology, 1998, 28, 1241-1250.
MOLLARET I., JAMIESON B . , ALDARD B . , HUGALL A., LECOINTRE G . , CHOMBARD C. & JUSTINE J.L. Phylogenetic analysis of the Monogenea and their relationship with Digenea and Euces- toda inferred from 28S rDNA sequences. Molecular and Biochemical Parasitology, 1997, 90, 433-438.
MOLLARET I., JAMIESON B. & JUSTINE J.L. Phylogeny of the Monopisthocotylea and Polyopisthocotylea (Platyhel
minthes) inferred from 28S rDNA sequences. Interna
tional Journal for Parasitology, 2000, 30, 171-185.
ROBINSON M., GOUY M., GAUTIER C . & MOUCHIROUD D. Sensi
tivity of the relative rate test to taxonomic sampling. Mole
cular Biology ands Evolution, 1998, 15, 1091-1098.
SICARD M., DESMARAIS E. & LAMBERT A. Molecular characteri
sation of Diplozoidae populations on five Cyprinidae spe
cies: consequences for host specificity. Comptes rendus de l'académie des sciences série 3 life sciences, 2001, 324, 8, 709-717.
Reçu le 15 octobre 2001 Accepté le 6 décembre 2001
Parasite, 2002, 9, 85-87
Note de recherche 87
