HAL Id: hal-00711304
https://hal.archives-ouvertes.fr/hal-00711304
Submitted on 23 Jun 2012HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Molecular detection of OXA carbapenemase genes in
multidrug-resistant isolates from Iraq and Georgia
Ia Kusradze, Seydina M. Diene, Marina Goderdzishvili, Jean-Marc Rolain
To cite this version:
Ia Kusradze, Seydina M. Diene, Marina Goderdzishvili, Jean-Marc Rolain. Molecular detection of OXA carbapenemase genes in multidrug-resistant isolates from Iraq and Georgia. International Jour-nal of Antimicrobial Agents, Elsevier, 2011, 38 (2), pp.164. �10.1016/j.ijantimicag.2011.03.021�. �hal-00711304�
Accepted Manuscript
Title: Molecular detection of OXA carbapenemase genes in multidrug-resistant Acinetobacter baumannii isolates from Iraq and Georgia
Authors: Ia Kusradze, Seydina M. Diene, Marina Goderdzishvili, Jean-Marc Rolain
PII: S0924-8579(11)00179-8
DOI: doi:10.1016/j.ijantimicag.2011.03.021 Reference: ANTAGE 3604
To appear in: International Journal of Antimicrobial Agents
Received date: 2-2-2011 Revised date: 22-3-2011 Accepted date: 28-3-2011
Please cite this article as: Kusradze I, Diene SM, Goderdzishvili M, Rolain J-M, Molecular detection of OXA carbapenemase genes in multidrug-resistant Acinetobacter
baumannii isolates from Iraq and Georgia, International Journal of Antimicrobial Agents (2010), doi:10.1016/j.ijantimicag.2011.03.021
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Accepted Manuscript
Molecular detection of OXA carbapenemase genes in
multidrug-resistant Acinetobacter baumannii isolates from Iraq and Georgia
Ia Kusradze a, Seydina M. Diene b, Marina Goderdzishvili a, Jean-Marc Rolain b,*
a
G. Eliava Institute of Bacteriophages, Microbiology and Virology. Gotua str. 3, 0160 Tbilisi, Georgia
b
Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergents (URMITE), CNRS-IRD, UMR 6236, Facultés de Médecine et de Pharmacie,
Université de la Méditerranée Aix-Marseille II, 27 Bd Jean Moulin, 13385 Marseille Cedex 05, France ARTICLE INFO Article history: Received 2 February 2011 Accepted 28 March 2011 Keywords: Acinetobacter baumannii Carbapenem-resistant
OXA carbapenemase genes
NDM-1
* Corresponding author. Tel.: +33 4 91 32 43 75; fax: +33 4 91 38 77 72.
E-mail address: jean-marc.rolain@univmed.fr (J.-M. Rolain).
Accepted Manuscript
ABSTRACT
The aim of this study was to determine the susceptibility to imipenem (IPM) of
Acinetobacter baumannii isolates from different countries and to characterise the
carbapenemase-encoding genes in IPM-resistant isolates. A total of 12 A. baumannii
strains collected in Belgium (n = 2), Iraq (n = 8) and Georgia (n = 2) were included in
the study. Identification of the isolates was confirmed using matrix-assisted laser
desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS). Antibiotic
susceptibility testing was performed by the disk diffusion method, and Etest was
used to determine the IPM minimum inhibitory concentrations (MICs) of resistant
isolates. The presence of carbapenemase-encoding genes was investigated by
polymerase chain reaction (PCR). All A. baumannii isolates were eventually
identified by MALDI-TOF MS with high score values. Among the 12 strains, 6 were
found to be resistant to IPM (MICs ≥ 16 g/mL), comprising clinical isolates from wound infections of soldiers who were injured either during the Iraq war in 2007 (5 isolates) or during the Georgian–Russian war in 2008 (1 isolate from Georgia). All
isolates contained ISAba1 and blaOXA-51-like, but isolates from Iraq contained the
blaOXA-23 gene located on a plasmid whereas the isolate from Georgia contained the
blaOXA-24 gene located on the chromosome. None of the IPM-resistant isolates
contain the blaOXA-58- or blaNDM-1-encoding genes. In conclusion, these results
re-emphasise the worldwide dissemination of OXA carbapenemase genes in
multidrug-resistant clinical isolates of A. baumannii and, to the best of our knowledge, reports
the first IPM-resistant A. baumannii strain isolated from a patient during the Georgian–Russian war with the blaOXA-24 gene located on the chromosome.
Accepted Manuscript
1. Introduction
Over the last decade, Acinetobacter baumannii has become a serious and emerging
nosocomial pathogen worldwide [1]. There is a wide variety of clinical manifestations
of A. baumannii infections, including hospital-acquired pneumonia, bloodstream
infection, urinary tract infection, meningitis and wound infections (especially in burn
units and in traumatic battlefield wounds) [1]. Acinetobacter baumannii has an
extraordinary ability to become resistant to almost all antibiotics, leading to
multidrug-resistant bacteria, through the acquisition of antibiotic resistance-encoding
genes by lateral gene transfer [2]. However, until recently most A. baumannii isolates
remained susceptible to carbapenems, although resistance to these compounds was
reported since the early 1990s [1]. Nevertheless, the rapid and worldwide
emergence of isolates resistant to carbapenems is now considered as a significant
health problem because of limited options for antibiotic treatment [1].
Carbapenemases found in Acinetobacter may belong to class B (metalloenzymes:
IMP, VIM, SIM) or to class D (OXA enzymes) carbapenemases, the latter being the
most frequently encountered worldwide [1]. The OXA enzymes may be divided into
four main subgroups, the acquired OXA-23-like, OXA-24-like and OXA-58-like and
the chromosomally located intrinsic OXA-51-like associated with ISAba1 upstream
[1]. Other OXA enzymes recently reported included OXA-143 in A. baumannii [3,4]
and OXA-134 in Acinetobacter lwoffii [5]. Nosocomial outbreaks of imipenem
(IPM)-resistant A. baumannii producing these OXA enzymes have been reported
worldwide: OXA-24-like (OXA-24, OXA-25, OXA-26 and OXA-40) were found in
Spain, Belgium, Portugal, Czech Republic, France and the USA; OXA-23-like
Accepted Manuscript
Australia, USA, Algeria, Egypt, Libya, South Africa, Thailand, Tunisia, South Korea,
Colombia, Iraq and French Polynesia; and OXA-58-like were identified in France,
Spain, Belgium, Turkey, Italy, Austria, Greece, UK, Argentina, Australia, USA,
Kuwait and Pakistan [1,6,7]. The blaOXA-51-like gene was originally found on the
chromosome but recently it has been reported that this gene can be located on plasmids and in this case ISAba1–blaOXA-51-like was enough to confer high-level
carbapenem resistance [8]. Finally, the coexistence of blaOXA-23 along with the new
blaNDM-1 metallo--lactamase has been recently demonstrated in clinical isolates of
A. baumannii from India [9].
The aim of this study was to determine the susceptibility to IPM of A. baumannii
isolates from different countries and to characterise the carbapenemase-encoding
genes in IPM-resistant isolates.
2. Materials and methods
2.1. Bacterial strains, identification and susceptibility testing
A total of 12 clinical isolates were used in this study. These strains were from the
collection of the G. Eliava Institute of Bacteriophages, Microbiology and Virology
(Tbilisi, Georgia) isolated from patients with wound infections, including 8 strains
from soldiers injured during the Iraq war in 2007, 2 strains from Georgia from soldiers injured during the Georgian–Russian War in 2008 and 2 strains from
Belgium also isolated from soldiers. Bacterial strains were grown at 37 C in brain– heart infusion broth and agar. Bacterial identification to species level was confirmed
Accepted Manuscript
(MALDI-TOF MS) (AutoflexTM; Bruker Daltonics, Bremen, Germany) with the Flex
control software (Bruker Daltonics) [10]. A score value >1.9 was considered for
identification at species level as previously reported [10]. The profiles obtained for
each strain were compared and analysed by MALDI Biotyper 2.0 software (Bruker
Daltonics) and finally adendrogram was created based on cross-wise minimum
spanning tree matching using the standard settings of the MALDI Biotyper 2.0
software.
Antibiotic susceptibility testing was performed by the disk diffusion method using a
panel of 14 different antibiotics, including rifampicin, amikacin,
piperacillin/tazobactam, gentamicin, piperacillin, colistin, tobramycin,
trimethoprim/sulfamethoxazole, ceftazidime, ticarcillin, ciprofloxacin, norfloxacin,
fosfomycin and IPM. Susceptibility breakpoints used were those recommended by
the European Committee on Antimicrobial Susceptibility Testing (EUCAST). For IPM,
according to EUCAST breakpoints an isolate should be considered as resistant to IPM if the inhibition zone diameter is <17 mm and susceptible if the diameter is ≥22
mm; for isolates with a diameter <17 mm, IPM minimum inhibitory concentrations
(MICs) were determined by Etest (AB BIODISK, Solna, Sweden) and resistance was
defined as isolates with an MIC for IPM >8 g/mL.
2.2. Molecular detection of carbapenemase-encoding genes and ISAba1
Primers used for amplification and sequencing of blaOXA-51-like, blaOXA-23, blaOXA-24,
blaOXA-58 and ISAba1 are given in Table 1. Positive polymerase chain reaction (PCR)
products were purified using a QIAquick PCR Purification Kit (QIAGEN, Courtaboeuf,
Accepted Manuscript
Biosystems, Foster City, CA). Results of sequencing were analysed with software
available on the Internet (http://www.ncbi.nlm.nih.gov). Real-time PCR was
performed to identify the blaNDM-1 gene using primers and TaqMan probe (Table 1).
2.3. Plasmid transfer by transformation
Putative plasmid DNA was purified from blaOXA-23- and blaOXA-24-positive A.
baumannii strains using a QIAprep Spin Miniprep Kit (QIAGEN). Absence of
contamination with other nucleic acids, including chromosomal DNA, was verified
after elution by agarose gel analysis of eluted plasmid DNA. Purified plasmids were
then used to transform IPM-sensitive A. baumannii strains using the following steps:
50 L of recipient strain with 5 L of plasmid was left in ice for 30 min and was then incubated at 42 C for 30 s, left for 2 min in ice again, and then 450 L of Luria– Bertani broth was added and incubated at 37 C for 1 h. After centrifugation,
transconjugants were plated on IPM-containing plates (8 g/mL) for 24 h at 37 C for selection of transformants. Colonies growing on IPM-containing plates were checked
for the presence of OXA-encoding genes by PCR using specific primers as
described above (Table 1).
3. Results
3.1. Phenotypic properties of the strains
All 12 isolates were eventually identified as A. baumannii using MALDI-TOF MS, with
score values above 2.2 for all strains. A dendrogram showing the relationship
Accepted Manuscript
this method into at least two clusters (distance level at 500, clusters A and B).
Cluster A contains only one isolate from Georgia (isolate G7), whereas cluster B
contains the other strains.
Results of antibiotic susceptibility testing for the strains are summarised in Table 2.
Among the 12 strains, 6 were found to be resistant to IPM (MICs ≥ 16 g/mL confirmed using Etest) (Table 2; Fig. 1) and were clinical isolates from wound
infections of soldiers who were injured either during the Iraq war in 2007 (5 isolates) or during the Georgian–Russian war in 2008 (1 isolate from Georgia). These six
isolates were also intermediate or fully resistant to the other antibiotics tested, except
colistin (Table 2).
3.2. Molecular characterisation of imipenem-resistant strains
All 12 strains were checked for the presence of carbapenemase-encoding genes
using the PCR methods described above. All of them were positive for blaOXA-51-like
and ISAba1 genes. The five IPM-resistant strains from Iraq contained the blaOXA-23
gene, whereas the IPM-resistant isolate from Georgia contained the blaOXA-24 gene.
Genes blaOXA-23 and blaOXA-24 from these strains were sequenced and the protein
sequence was compared with GenBank database using the BLAST tool and were
100% identical to that of GenBank accession nos. HQ700358 and HQ219688 for
blaOXA-23 and blaOXA-24, respectively. All of the remaining susceptible strains did not
contain blaOXA-23- or blaOXA-24-encodinggenes. Finally, none of the 12 strains
Accepted Manuscript
Finally, plasmids from these 12 strains were extracted and purified and the same
PCR methods as above were performed, showing that the blaOXA-51-like gene was
present in all plasmids whereas the blaOXA-23 gene was present in five plasmids
corresponding to the five IPM-resistant strains from Iraq (Fig. 1). Conversely, PCR
for the blaOXA-24 gene was negative for all strains, suggesting that the blaOXA-24
-encodinggene detected in the IPM-resistant strain from Georgia (isolate G7) was
chromosomally encoded. Finally, PCR for the ISAba1 gene was positive for nine
plasmids (Fig. 1).
The six plasmids isolated from resistant strains were used to transform two
IPM-sensitive A. baumannii isolates (isolate 2 and 280) and were successfully cultured on
IPM-containing plates (8 g/mL).
4. Discussion
Since the first description of the first acquired OXA carbapenemase in A. baumannii
in 1993, the emergence and spread of acquired OXA enzymes has been well
documented worldwide [1]. In this study, we have described six IPM-resistant A.
baumannii clinical isolates recovered from 12 soldiers injured either during the Iraq
war or the Georgian–Russian War in 2008. These six strains were resistant to almost
all antibiotics tested except colistin. Interestingly, all isolates were correctly identified
by MALDI-TOF, confirming the accuracy of this technique for routine bacterial
identification [10]. To the best of our knowledge, this was not previously reported for
A. baumannii [10]. In the present study, all isolates contained an intrinsic blaOXA-51-like
Accepted Manuscript
known to have only weak carbapenem-hydrolysing activity. However, overexpression
of this carbapenemase by promoters located in upstream insertion sequences such
as ISAba1 may be associated with carbapenem resistance in A. baumannii [8]. It has
recently been reported that isolates from Taiwan with a plasmid bearing the ISAba1–
blaOXA-51-like gene that did not contain other OXA-encoding genes had higher rates of
resistance to IPM compared with isolates with a chromosomally encoded ISAba1–
blaOXA-51-like gene [13]. In the present study, five of the strains containing a plasmid
bearing both ISAba1 and blaOXA-51-like genes but that did not contain other
OXA-encoding genes were still susceptible to IPM (isolates G3, 2, 1, 257 and 10) (Fig. 1).
Such discrepancy may be explained by a synergistic effect from other determinants
located on the plasmids for the isolates previously reported in Taiwan [13] or by
another location of ISAba1 in the plasmids.
In this study, the five isolates recovered from soldiers during the Iraq conflict
contained a blaOXA-23 gene that was located on a plasmid. It is well known that the
blaOXA-23 gene is one of the most prevalent carbapenemase-encoding genes
worldwide, which can be located on the chromosome or plasmids in different genetic
structures [1,6]. IPM-resistant isolates recovered from American and British soldiers
repatriated from the Iraq conflict have been reported to be associated either with
OXA-23- or OXA-58-encoding genes [14]. However, to the best of our knowledge,
we report the first clinical isolate of IPM-resistant A. baumannii with an
OXA-24-encoding gene chromosomally encoded in a soldier who was injured during the Georgian–Russian war in 2008 who was treated in the Military Hospital of Gori,
Georgia. The isolate was recovered in January 2009 from sputum during his stay in
Accepted Manuscript
gene may be located either on the chromosome or on plasmids [1]. Interestingly, the
isolate in this study contains both a plasmid bearing the ISAba1 and blaOXA-51-like
genes and a blaOXA-24 gene chromosomally encoded and, interestingly, A. baumannii
transformants bearing this plasmid only were resistant to IPM as with isolates from
Taiwan [13]. The NDM-1 metallo--lactamase detected recently in
Enterobacteriaceae and also in A. baumannii, especially in patients from India and
Pakistan [15], as well as blaOXA-58 were not detected in any isolates in this study.
These results re-emphasise the worldwide dissemination of OXA carbapenemase
genes in multidrug-resistant clinical isolates of A. baumannii and, to the best of our
knowledge, we report the first IPM-resistant A. baumannii strain isolated in a patient during the Georgian–Russian war with the blaOXA-24 gene located on the
chromosome.
Acknowledgment
The authors thank Linda Hadjadj for technical assistance.
Funding
This work was partly funded by the Centre National de la Recherche Scientifique
(CNRS) (France).
Competing interests
None declared.
Accepted Manuscript
Accepted Manuscript
References
[1] Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev 2008;21:538–82.
[2] Fournier PE, Vallenet D, Barbe V, Audic S, Ogata H, Poirel L, et al. Comparative
genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet
2006;2:e7.
[3] Higgins PG, Poirel L, Lehmann M, Nordmann P, Seifert H. OXA-143, a novel
carbapenem-hydrolyzing class D -lactamase in Acinetobacter baumannii. Antimicrob Agents Chemother 2009;53:5035–8.
[4] Antonio CS, Neves PR, Medeiros M, Mamizuka EM, Elmor de Araujo MR,
Lincopan N. High prevalence of carbapenem-resistant Acinetobacter baumannii
carrying the blaOXA-143 gene in Brazilian hospitals. Antimicrob Agents Chemother
2011;55:1322–3.
[5] Figueiredo S, Poirel L, Seifert H, Mugnier P, Benhamou D, Nordmann P.
OXA-134, a naturally occurring carbapenem-hydrolyzing class D -lactamase from
Acinetobacter lwoffii. Antimicrob Agents Chemother 2010;54:5372–5.
[6] Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the
blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis 2010;16:35–40.
[7] Drissi M, Poirel L, Mugnier PD, Baba AZ, Nordmann P.
Carbapenemase-producing Acinetobacter baumannii, Algeria. Eur J Clin Microbiol Infect Dis 2010;29:1457–8.
Accepted Manuscript
[8] Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, et al.
The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter
baumannii. FEMS Microbiol Lett 2006;258:72–7.
[9] Karthikeyan K, Thirunarayan MA, Krishnan P. Coexistence of blaOXA-23 with
blaNDM-1 and armA in clinical isolates of Acinetobacter baumannii from India. J Antimicrob Chemother 2010;65:2253–4.
[10] Seng P, Drancourt M, Gouriet F, La Scola B, Fournier PE, Rolain JM, et al.
Ongoing revolution in bacteriology: routine identification by matrix-assisted laser
desorption ionization time-of-flight mass spectrometry. Clin Infect Dis 2009;49:543–51.
[11] Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL.
Identification of Acinetobacter baumannii by detection of the blaOXA-51-like
carbapenemase gene intrinsic to this species. J Clin Microbiol 2006;44:2974–6.
[12] Ruiz M, Marti S, Fernandez-Cuenca F, Pascual A, Vila J. High prevalence of
carbapenem-hydrolysing oxacillinases in epidemiologically related and unrelated
Acinetobacter baumannii clinical isolates in Spain. Clin Microbiol Infect
2007;13:1192–8.
[13] Chen TL, Lee YT, Kuo SC, Hsueh PR, Chang FY, Siu LK, et al. Emergence
and distribution of plasmids bearing the blaOXA-51-like gene with an upstream
ISAba1 in carbapenem-resistant Acinetobacter baumannii isolates in Taiwan. Antimicrob Agents Chemother 2010;54:4575–81.
[14] Turton JF, Kaufmann ME, Gill MJ, Pike R, Scott PT, Fishbain J, et al.
Comparison of Acinetobacter baumannii isolates from the United Kingdom and
the United States that were associated with repatriated casualties of the Iraq conflict. J Clin Microbiol 2006;44:2630–4.
Accepted Manuscript
[15] Rolain JM, Parola P, Cornaglia G. New Delhi metallo--lactamase (NDM-1): towards a new pandemia? Clin Microbiol Infect 2010;16:1699–701.
Accepted Manuscript
Fig. 1. Cross-wise minimum spanning tree (MSP) dendrogram representing therelationship between Acinetobacter baumannii strains isolated in different countries.
R, resistant (inhibition zone diameter <17 mm); S, sensitive (inhibition zone diameter ≥22 mm). Minimum inhibitory concentrations (MICs) determined by the Etest
Accepted Manuscript
Table 1Primers and probe used in the study
Target Primer name Primer sequence Amplicon size (bp) Reference/source
blaOXA-51-like OXA51like-F TAATGCTTTGATCGGCCTTG 353 [11]
OXA51like-R TGGATTGCACTTCATCTTGG
blaOXA-23 OXA23-F GATCGGATTGGAGAACCAGA 501 [11]
OXA23-R ATTTCTGACCGCATTTCCAT
blaOXA-24 OXA24-F ATGAAAAAATTTATACTTCCTATATTCAGC 825 [12]
OXA24-R TTAAATGATTCCAAGATTTTCTAGC
blaOXA-58 OXA58-F AGTATTGGGGCTTGTGCT 453 [12]
OXA58-R AACTTCCGTGCCTATTTG
ISAba1 ISAba-F CATTGGCATTAAACTGAGGAGAAA 451 [12] ISAba-R TTGGAAATGGGGAAAACGAA
blaNDM-1 NDM1-F GCGCAACACAGCCTGACTTT 155 This study
NDM1-R CAGCCACCAAAAGCGATGTC
NDM-1 probe Fam-CAACCGCGCCCAACTTTGGC-TAMRA
Accepted Manuscript
Table 2Antibiotic susceptibility of the 12 Acinetobacter baumannii clinical isolates
Antibiotic (concentration)
Susceptibility [(inhibition zone diameter (mm)] 1 (Iraq) 2 (Iraq) 3 (Iraq) 4 (Iraq) 5 (Iraq) 6 (Iraq) 9 (Iraq) 10 (Iraq) 257 (Belgium) 280 (Belgium) G3 (Georgia) G7 (Georgia) RIF (30 mg/L) I (17) I (15) I (15) I (15) I (16) I (15) I (16) I (14) I (16) I (16) I (14) I (14) CAZ (30 mg/L) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (8) R (6) PIP (75 mg/L) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) I (14) I (13) R (8) R (6) TZP (85 mg/L) I (18) I (15) R (6) R (6) R (8) R (8) R (8) I (16) I (17) I (15) R (10) R (10) CIP (5 mg/L) R (6) R (14) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (10) NOR (5 mg/L) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) FOS (50 mg/L) R (6) R (6) R (6) R (6) R (6) R (7) R (6) R (6) R (6) R (6) R (6) R (6) COL (50 mg/L) S (16) S (16) S (16) S (16) S (16) S (17) S (16) S (16) S (15) S (15) S (15) S (16) SXT (25 mg/L) R (6) I (15) R (7) R (7) R (6) R (6) R (8) R (6) R (6) I (10) R (6) R (6) GEN (15 mg/L) R (7) S (22) R (6) R (6) R (6) R (6) R (6) R (6) S (18) I (17) S (20) R (6) AMI (30 mg/L) R (10) S (17) R (13) R (12) R (10) R (12) R (14) R (10) R (10) R (11) R (10) R (10) Edited Table 2
Accepted Manuscript
TOB (10 mg/L) R (6) S (18) R (8) R (8) R (6) R (7) R (9) R (6) S (18) S (18) S (18) R (6) TIC (75 mg/L) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (6) R (10) R (6) R (14) R (6) IPM (10 mg/L) S (30) S (32) R (14) R (15) R (14) R (12) R (12) S (25) S (30) S (25) S (26) R (6)IPM Etest MIC (g/mL)
0.38 0.38 16 32 16 32 16 0.75 1 0.75 0.5 32
RIF, rifampicin; CAZ, ceftazidime; PIP, piperacillin; TZP, piperacillin/tazobactam; CIP, ciprofloxacin; NOR, norfloxacin; FOS,
fosfomycin; COL, colistin; SXT, sulfamethoxazole/trimethoprim; GEN, gentamicin; AMI, amikacin; TOB, tobramycin; TIC, ticarcillin;
Accepted Manuscript
0 100 200 300 400 500 600 700 800 900 1000 MSP Dendrogram Strains IPM sensitivity (MICs) OXA-51like ISAba1 OXA-23like OXA-24like A. baumannii G3 S (0.5) +a +a - -A. baumannii G7 R (32) +a +a - + A. baumannii 2 S (0.38) +a +a - -A. baumannii 280 S (0.75) +a + - -A. baumannii 6 R (32) +a +a +a -A. baumannii 257 S (1) +a +a - -A. baumannii 1 S (0.38) +a +a - -A. baumannii 9 R (16) +a +a +a -A. baumannii 3 R (16) +a +a +a -A. baumannii 5 R (16) +a + +a -A. baumannii 4 R (32) +a + +a -A. baumannii 10 S (0.75) +a +a --Strains from Georgia
Strains from Belgium
Strains from Iraq