Development of microsatellite markers in Capsella Rubella and Capsella Bursa-Pastoris (Brassicaceae) 1

(1)

e176

American Journal of Botany: e176–e179. 2011.

The Brassicaceae are an important family of about 338

genera distributed worldwide. It includes several species of

crops, weeds, ornamentals, and the model organism Arabidopsis

thaliana (L.) Heynh. Capsella bursa-pastoris (L.) Medik. and

Capsella rubella Reut. belong to a small genus with only three

species. Capsella species are closely related to the model

organ-ism Arabidopsis thaliana ( Couvreur et al., 2010 ). Capsella rubella

is diploid (2 n = 2 x = 16). It grows around the Mediterranean

Sea, and, more occasionally, in America and Australia where it

was introduced ( Hurka and Neuffer, 1997 ). Capsella rubella

has been described as a highly selfi ng plant ( Hurka et al., 1989 )

and has attracted attention as a model system for comparative

genomic studies in crucifers ( Boivin et al., 2004 ). Complete

genomic sequencing of C. rubella is under way, and sequences

are currently available on the NCBI Trace archive (http://

www.ncbi.nlm.nih.gov/Traces/home/). Capsella bursa-pastoris

(shepherd ’ s purse) is tetraploid (2 n = 4 x = 32). It is

distrib-uted in ruderal habitats all over the world except in the

trop-ics ( Hurka and Neuffer, 1997 ). Capsella bursa-pastoris is a

predominantly selfi ng species with a fl exible mating system

( Hurka et al., 1989 ).

Genetic variation in Capsella has been investigated using

en-zyme systems ( Hurka and Neuffer, 1997 ) and, more recently,

gene sequencing ( Slotte et al., 2008 ). Genetic variation was

found to be low, especially in C. rubella. To explore genetic

variation using highly polymorphic markers, we developed 17

microsatellite loci.

METHODS AND RESULTS

Microsatellite marker identifi cation was performed in silico using C. rubella genomic sequences deposited in the NCBI Trace archive (http://www.ncbi.nlm. nih.gov/Traces/home/) by the DOE Joint Genome Institute, US department of Energy. Fasta-formatted sequences were submitted to the high-throughput web application BatchPrimer3 ( You et al., 2008 , http://probes.pw.usda.gov/cgi-bin/ batchprimer3/batchprimer3.cgi) to screen for di- and trinucleotide perfect mic-rosatellite repeat motifs and to design corresponding PCR primers. Only di-nucleotides with more than 8 repeats and tri-di-nucleotides with more than 5 repeats were retained.

An initial set of 100 primer pairs was tested for PCR amplifi cation on six C.

rubella accessions and six C. bursa-pastoris accessions, each originating from

a different population sample. Geographic origins of the population samples are listed in Appendix 1. DNA was extracted from leaf tissue using the protocol of Doyle and Doyle (1987) . PCR amplifi cations were performed using a Master-cycler (Eppendorf, Hamburg, Germany) thermoMaster-cycler, in 20- μ L reaction mix containing 70 mM Tris-HCl, 2 mM MgCl 2 , 17 mM (NH 4 )2SO 4 , 10 mM

beta-mercaptoethanol, 0.05% (wt/vol) polyoxyethylene-ether W1, 0.2 mg/ml bovine serum albumin, 200 mM each dNTP, 10 ng genomic DNA, 0.5 units of Taq DNA polymerase, and 2.08 10 − 1_{µ M of each reverse and forward microsatellite}

primers. The reaction mixture was initially denatured at 95 ° C for 5 min, fol-lowed by 37 cycles of amplifi cation at 95 ° C for 5 s, 60 ° C for 10 s and 72 ° C for 30 s. Success of amplifi cation was assessed using a LI-COR 4000L automated sequencer (LI-COR biosciences, Lincoln, Nebraska, USA) and 6.5% polyacryl-amide gels. Fragments that resulted in a strong amplifi cation signal in all acces-sions were sequenced on both strands to confi rm the presence of the predicted microsatellite repeat motif. Finally, 17 primer pairs that amplifi ed a microsatel-lite repeat motif and that were found to be polymorphic within at least one of the two Capsella species were retained ( Table 1 ) .

The polymorphism of the selected microsatellite markers was assessed on four population samples for each species: for C. rubella , Auzat, F é nay, Paray-Douaville, and Patrimonio; for C. bursa pastoris , F é nay, Hamar, Roquemaure, and Saint-Mars-La-Jaill é (Appendix 1 and Fig.1 ) . PCR products were dye-labeled (6-FAM, NED, VIC, PET) and assayed on an ABI 3730XL sequencer (Applied Biosystems, Foster City, California, USA) using 500 liz as a size stan-dard. Allele sizes were analyzed with Peak Scanner 1.0 (Applied Biosystems). Parameters of genetic diversity including the expected heterozygosity ( H e ),

observed heterozygosity ( H o ), and number of alleles ( Na ) were obtained using

GenAlex 6.4 ( Peakall and Smouse, 2006 ). Tests for linkage disequilibrium were performed using FSTAT 2.9.3 ( Goudet, 1995 ). Sequential Bonferroni

1_{Manuscript received 17 February 2011; revision accepted 18 March 2011.}

C.M.L.C. benefi ted from a grant from the French Ministry of Higher Education and Research.

4_{Author for correspondence: lecorre@dijon.inra.fr}

doi:10.3732/ajb.1100081

AJB Primer Notes & Protocols in the Plant Sciences

DEVELOPMENT OF MICROSATELLITE MARKERS IN C

APSELLA

RUBELLA

AND C

APSELLA

BURSA

-

PASTORIS

(B

RASSICACEAE)

1 Coraline M. L. Caullet

2

_{, Fanny Pernin}

2

_{, Charles Poncet}

3

_,

and Val é rie Le Corre

2,4

2_{INRA, UMR Biologie et Gestion des Adventices, BP 86510 21065 Dijon Cedex, France; and}3_{INRA, Plateforme de}

G é notypage Gentyane, UMR GDEC, 234 avenue du Br é zet 63100 Clermont-Ferrand, France

• Premise of the study: We developed microsatellite markers to investigate genetic diversity within and among populations of Capsella rubella and Capsella bursa-pastoris and between these two species.

• Methods and Results: Fourteen polymorphic microsatellite loci were identifi ed in the two species and one more polymorphic microsatellite locus only in C. rubella . Samples from different European localities were genotyped. Up to six alleles per locus were observed in C. rubella , and up to 22 alleles per locus in C. bursa-pastoris . Observed heterozygosities were low, indicating high selfi ng rates, especially in C. rubella .

• Conclusions: The results provide valuable information on genetic diversity for future studies of population genetics in C. rubella and C. bursa-pastoris .

(2)

e177

July 2011]

AJB Primer Notes & Protocols — C

APSELLA

microsatellites

Table 1. Characteristics of 17 microsatellite markers developed in Capsella . Shown for each primer pair are the forward (F) and reverse (R) primer sequences, repeat type, allele size range (bp), annealing temperature ( T a ) and GenBank accession number.

Locus Primer sequences (5 ′ – 3 ′ ) Repeat Motif

Size Range (bp)

T a ( ° C) GenBank Accession No.

C. rubella C. bursa-pastoris

ATTS0392 F: TTTGGAGTTAGACACGGATCTG (AAG) 8 192 – 198 195 – 204 60 gnl|ti|2141870946

R: GTTGATCGCAGCTTGATAAGC

CaruSSR1 F: TATGCAATACCGAAGATGACCTTAT (TC) 12 189 – 191 170 – 176 60 gb|EF197847.1

R: ACACATGTCTTACCAGCTACACAAA

CaruSSR18 F: TTTTTAGTTCCTCTGCGTCTTCTTA (TC) 13 169 – 181 169 – 187 60 gb|AY350713.1

R: AACGAGAAAGATTTGATCTTGAATG

CaruSSR23 F: AGTGGACCCTTGATTTACTTCTTC (CT) 10 139 – 147 133 – 149 60 gb|AF248980.1

R: CTTTGTCTTGGAAAGATTTGGTG

CaruSSR40 F: CGCTTCTCCTCCAATCACTC (TCT) 5 271 – 284 — 60 gnl|ti|2141951277

R: TTCTCTATCTCCTCCTCCTCCTC

CaruSSR44 F: GGAAGAAGAAGAAGAAGAAGAAGAC (AAG) 13 221 – 227 212 – 221 60 gnl|ti|2142016002

R: GCAATACAAGGCACCAAAC

CaruSSR49 F: GAAGACAGCGAGAGAAGAAAGTG (CTT) 5 234 – 237 230 – 248 60 gnl|ti|2142059591

R: TGAAGCAGAAGAAGAAGAAGCAG

CaruSSR60 F: AAGCACCAAGCCATCACAG (AG) 32 213 – 260 — 60 gnl|ti|2141926753

R: GAACCATCAATACGAAGAGAAGAG

CaruSSR61 F: CGGACAAAGAAGAAGATAGAACAG (GA) 16 247 – 252 — 60 gnl|ti|2141814077

R: ATAAACGGGACGAATGAAGG

CaruSSR65 F: CAGAAGAGAAGAAGTGGGTGTC (AAT) 10 210 – 213 194 – 200 60 gnl|ti|2141686205

R: TGGAAGTGAGTGAAGAAGAAAGAG

Carussr80 F: TCCGTTACCTTCACGATACTTTG (AG) 30 223 – 243 198 – 200 60 gnl|ti|2141645261

R: GATGGCTCTTTGCCGTTC

CaruSSR82 F: GTTTCTCTCCGCAAATGATGG (CAT) 13 310 – 323 304 – 316 60 gnl|ti|2141693583

R: TTTCTTTCGTATTGGTGTATCTG

CaruSSR83 F: TCGGTAAACAAACGAACCAATC (AG) 15 313 – 315 223 – 345 60 gnl|ti|2141811428

R: GATGATGAAGAACAACAGCCAAG

CaruSSR89 F: GTGGAAACGAGAGGAAGAAGAG (TCT) 9 191 – 197 174 – 197 60 gnl|ti|2142036253

R: GAAGTGACGACGATGAGAGATTG

CaruSSR90 F: CTTGTTGGTCTCCAGGTATG (CT) 25 274 – 288 264 – 266 60 gnl|ti|2141723802

R: GATGGGAAGGGAAGAGTATTATG

CaruSSR96 F: GACCTCTGGCTACTCCCACAC (AG) 12 155 – 157 159 – 161 60 gnl|ti|2142025654

R: CAACTTCTACTCCAATCCATCATC

CaruSSR97 F: CACGGGCAGCAAGAAAGG (AT) 17 162 – 168 156 – 184 60 gnl|ti|2142017685

R: TAAAGGTGACAGACAATCTCAGG

All the primers except CaruSSR40, CaruSSR60, and CaruSSR61 successfully amplifi ed in C. bursa-pastoris.

Table 2. Results of initial primer screening in C. rubella (a) and in C. bursa-pastoris (b). Shown for each locus are the sample size for each population ( N ), number of alleles ( N a ), observed heterozygosity ( H o ) and expected heterozygosity ( H e ). Asterisks indicate signifi cant departure from HWE after

Bonferroni correction ( P < 0.003).

(a) Auzat ( N = 9) Paray-Douaville ( N = 9) Patrimonio ( N = 10) F é nay ( N = 40) Locus N a H o H e N a H o H e N a H o H e N a H o H e ATTS0392 1 0.000 0.000 1 0.000 0.000 2 0.000 0.420* 2 0.000 0.095* CaruSSR1 1 0.000 0.000 1 0.000 0.000 2 0.000 0.320* 1 0.000 0.000 CaruSSR18 2 0.000 0.444* 1 0.000 0.000 1 0.000 0.000 3 0.029 0.184* CaruSSR23 1 0.000 0.000 1 0.000 0.000 4 0.000 0.660* 1 0.000 0.000 CaruSSR40 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 CaruSSR44 2 0.000 0.444* 2 0.111 0.105 3 0.000 0.540* 1 0.000 0.000 CaruSSR49 2 0.000 0.444* 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 CaruSSR60 2 0.000 0.494* 1 0.000 0.000 4 0.000 0.741* 1 0.000 0.000 CaruSSR61 2 0.000 0.444* 1 0.000 0.000 2 0.000 0.490 2 0.000 0.153* CaruSSR65 2 0.000 0.444 1 0.000 0.000 2 0.000 0.320 1 0.000 0.000 CaruSSR80 2 0.000 0.408 1 0.000 0.000 2 0.000 0.346* 3 0.000 0.220* CaruSSR82 2 0.000 0.198* 1 0.000 0.000 2 0.000 0.480 1 0.000 0.000 CaruSSR83 1 0.000 0.000 1 0.000 0.000 2 0.000 0.180* 2 0.000 0.108* CaruSSR89 2 0.000 0.444* 1 0.000 0.000 3 0.000 0.568* 2 0.000 0.124* CaruSSR90 2 0.000 0.444* 1 0.000 0.000 4 0.000 0.660 3 0.000 0.152* CaruSSR96 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 CaruSSR97 1 0.000 0.000 1 0.000 0.000 3 0.000 0.620* 4 0.105 0.376*

correction was used in multiple comparisons ( Rice, 1989 ). Results are presented in Table 2 .

In C. rubella , two markers were monomorphic across all populations. The observed number of alleles at the remaining 15 loci ranged from 1 to 6. In C.

bursa-pastoris , the 14 markers that gave good PCR amplifi cation were all

poly-morphic. The number of alleles per locus across all populations ranged from 2 to 22. Within each C. rubella population, from 1 to 4 alleles per locus (mean: 1.7) were observed, H o ranged from 0.000 to 0.111 (mean: 0.004) and H e ranged

from 0.000 to 0.741 (mean: 0.178). All loci signifi cantly deviated from HWE due to heterozygote defi ciency ( Table 2.a ). Within each C. bursa-pastoris

(3)

popu-e178

American Journal of Botany

[Vol. 0

(b) Saint-Mars-La-Jaill é ( N = 10) Hamar ( N = 8) Roquemaure ( N = 8) F é nay ( N = 40) Locus N a H o H e N a H o H e N a H o H e N a H o H e ATTS0392 2 0.000 0.444 2 0.000 0.278 2 0.000 0.375 4 0.037 0.346* CaruSSR1 1 0.000 0.000 3 0.375 0.570 1 0.000 0.000 1 0.000 0.000 CaruSSR18 2 0.000 0.320* 4 0.000 0.688* 2 0.250 0.469 6 0.059 0.750* CaruSSR23 3 0.100 0.265 2 0.000 0.444 1 0.000 0.000 5 0.026 0.554* CaruSSR44 2 0.000 0.420* 1 0.000 0.000 1 0.000 0.000 4 0.105 0.613* CaruSSR49 2 0.000 0.320* 3 0.000 0.594* 2 0.000 0.219 3 0.050 0.529* CaruSSR65 2 0.000 0.320* 3 0.000 0.571* 1 0.000 0.000 2 0.030 0.493* CaruSSR80 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 2 0.000 0.193* CaruSSR82 1 0.000 0.000 2 0.000 0.469 1 0.000 0.000 3 0.029 0.085* CaruSSR83 3 0.000 0.580* 4 0.000 0.656* 3 0.500 0.633 12 0.205 0.889* CaruSSR89 1 0.000 0.000 1 0.000 0.000 1 0.000 0.000 4 0.079 0.322* CaruSSR90 1 0.000 0.000 1 0.000 0.000 2 0.000 0.219 1 0.000 0.000 CaruSSR96 1 0.000 0.000 1 0.000 0.000 2 0.375 0.305 2 0.025 0.200* CaruSSR97 4 0.000 0.700* 3 0.250 0.633 5 0.500 0.680 7 0.100 0.733*

Fig. 1. Geographical distribution of the population samples used to assess polymorphism of the microsatellites. Populations of C. rubella are marked as red spots with a star; populations of C. bursa-pastoris are marked as green spots with a circle; population F é nay, where both species were sampled, is marked as a blue spot. The map was created using Google Earth (http://www.google.fr/intl/fr/earth/index.htm).

lation, from 1 to 12 alleles per locus (mean: 2.4) were observed, H o ranged from

0.000 to 0.500 (mean: 0.045) and H e ranged from 0.000 to 0.889 (mean: 0.296).

Only two loci (CaruSSR1, CaruSSR90) did not signifi cantly deviate from

HWE. The other loci signifi cantly deviated from HWE due to heterozygote defi ciency ( Table 2.b ). Signifi cant linkage disequilibrium was not found for any pair of polymorphic loci for either of the two species.

(4)

e179

July 2011]

AJB Primer Notes & Protocols — C

APSELLA

microsatellites

CONCLUSIONS

Fifteen microsatellite markers for C. rubella and 14 for C.

bursa-pastoris showed enough polymorphism for studying

ge-netic variation in these species. Capsella rubella was found to

be less genetically variable than C. bursa-pastoris and displayed

lower levels of observed heterozygosity, in agreement with

ear-lier fi ndings based on other kinds of genetic data ( Hurka et al.,

1989 ; Slotte et al., 2008 ). Notably, the microsatellite markers

developed here were polymorphic among populations as well

as within populations. They will therefore be helpful to

investi-gate population structure, genetic variation, and population

ecology in these species.

LITERATURE CITED

Boivin , K. , A. Acarkan , R. S. Mbulu , O. Clarenz , and R. Schmidt . 2004 . The Arabidopsis genome sequence as a tool for genome analy-sis in Brassicaceae. A comparison of the Arabidopanaly-sis and Capsella

rubella genomes. Plant Physiology 135 : 735 – 744 .

Couvreur , T. L. P. , A. Franke , I. A. Al-Shehbaz , F. T. Bakker , M. A. Koch , and K. Mummenhoff . 2010 . Molecular phyloge-netics, temporal diversifi cation, and principles of evolution in the

mustard family (Brassicaceae). Molecular Biology and Evolution 27 : 55 – 71 .

Doyle , J. J. , and J. L. Doyle . 1987 . Isolation of DNA from fresh plant tissue. Focus 12 : 13 – 15 .

Goudet , J. 1995 . FSTAT (version 1.2): A computer program to calculate F-statistics. The Journal of Heredity 86 : 485 – 486 .

Hurka , H. , S. Freundner , A. H. D. Brown , and U. Plantholt . 1989 . Aspartate aminotransferase isozymes in the genus Capsella ( Brassicaceae ): Subcellular location, gene duplication, and polymor-phism. Biochemical Genetics 27 : 77 – 90 .

Hurka , H. , and B. Neuffer . 1997 . Evolutionary processes in the ge-nus Capsella (Brassicaceae). Plant Systematics and Evolution 206 : 295 – 316 .

Peakall , R. , and P. E. Smouse . 2006 . GENALEX 6: Genetic analy-sis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6 : 288 – 295 .

Rice , W. R. 1989 . Analyzing tables of statistical tests. Evolution;

International Journal of Organic Evolution 43 : 223 – 225 .

Slotte , T. , H. Huang , M. Lascoux , and A. Ceplitis . 2008 . Polyploid speciation did not confer instant reproductive isolation in Capsella (Brassicaceae). Molecular Biology and Evolution 25 : 1472 – 1481 . You , F. M. , N. Huo , Y. Q. Gu , M. Luo , Y. Ma , D. Hane , G. R. Lazo ,

et al . 2008 . BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinformatics 9 : 253 .

Appendix 1. Geographic origins of C. rubella and C. bursa-pastoris populations used in this study.

Population Country, District Latitude Longitude

C. rubella

Auzat France, Ari è ge 42 ° 41 ′ 30 ″ N 01 ° 27 ′ 00 ″ E

Chevannes France, Yonne 47 ° 45 ′ 30 ″ N 03 ° 28 ′ 40 ″ E

F é nay France, C ô te d ’ Or 47 ° 13 ′ 49 ″ N 05 ° 03 ′ 30 ″ E

Montmerle-sur-Saone France, Ain 46 ° 04 ′ 12 ″ N 04 ° 46 ′ 07 ″ E

Paray-Douaville France, Yvelines 48 ° 28 ′ 20 ″ N 01 ° 52 ′ 00 ″ E

Patrimonio France, Corsica 42 ° 41 ′ 54 ″ N 09 ° 21 ′ 44 ″ E

C. bursa-pastoris

F é nay France, C ô te d ’ Or 47 ° 13 ′ 49 ″ N 05 ° 03 ′ 30 ″ E

Hamar Norway, Hedmark 60 ° 44 ′ 00 ″ N 11 ° 07 ′ 00 ″ E

L ö rch Germany, Rheingau-Taunus-Kreis 48 ° 47 ′ 00 ″ N 09 ° 41 ′ 00 ″ E

La Grande Motte France, H é rault 43 ° 33 ′ 52 ″ N 04 ° 06 ′ 09 ″ E

Roquemaure France, Gard 44 ° 02 ′ 17 ″ N 04 ° 46 ′ 00 ″ E