Physiologia Plantarum 154: 256–269. 2015 © 2014 Scandinavian Plant Physiology Society, ISSN 0031-9317
Identification and molecular characterization of Medicago truncatula NRT2 and NAR2 families
Anthoni Pellizzaroa,b, Thibault Clocharda,b, Elisabeth Plancheta,b, Anis M. Limamia,b,*and Marie-Christine Morère-Le Pavena,b
aUniversité d’Angers, UMR1345 Institut de Recherche en Horticulture et Semences, SFR4207 QUASAV, 2 Boulevard Lavoisier, F-49045 Angers, France
bINRA, UMR1345 Institut de Recherche en Horticulture et Semences, 42 rue Georges Morel, F-49071 Beaucouzé, France
Correspondence
*Corresponding author, e-mail: [email protected] Received 23 October 2014;
revised 22 November 2014 doi:10.1111/ppl.12314
Nitrate transporters received little attention to legumes probably because these species are able to adapt to N starvation by developing biological N2 fixa- tion. Still it is important to study nitrate transport systems in legumes because nitrate intervenes as a signal in regulation of nodulation probably through nitrate transporters. The aim of this work is to achieve a molecular character- ization of nitrate transporter 2 (NRT2) and NAR2(NRT3) families to allow further work that would unravel their involvement in nitrate transport and signaling. Browsing the latest version of the Medicago truncatula genome annotation (v4 version) revealed three putativeNRT2members that we have named MtNRT2.1 (Medtr4g057890.1), MtNRT2.2 (Medtr4g057865.1) and MtNRT2.3(Medtr8g069775.1) and two putativeNAR2members we named MtNAR2.1(Medtr4g104730.1) andMtNAR2.2(Medtr4g104700.1). The reg- ulation and the spatial expression profiles ofMtNRT2.1, the coincidence of its expression with that of MtNAR2.1 and MtNAR2.2 and the size of the encoded protein with 12 transmembrane (TM) spanning regions strongly sup- port the idea thatMtNRT2.1is a nitrate transporter with a major contribution to the high-affinity transport system (HATS), while a very low level of expres- sion characterizedMtNRT2.2. UnlikeMtNRT2.1,MtNRT2.3showed a lower level of expression in the root system but was expressed in the shoots and in the nodules thus suggesting an involvement of the encoded protein in nitrate transport inside the plant and/or in nitrate signaling pathways control- ling post-inoculation processes that govern nodule functioning.
Introduction
Nitrate transport systems were thoroughly studied in Arabidopsis thaliana for both transport and signaling roles (Nacry et al. 2013). The nitrate transporter 1/pep- tide transporter (NPF) family, formerly called NRT1/PTR family, is characterized by a high number of members (53 genes). Most of the NPF functionally characterized to date are low-affinity nitrate transporters (participating in the low-affinity transport system, LATS) at the exception
Abbreviations – HATS, high-affinity transport system; LATS, low-affinity transport system; NNP, nitrate/nitrite porter; NPF, nitrate transporter 1/peptide transporter family; NRT2, nitrate transporter 2; TM, transmembrane.
of AtNPF6.3 (Chl1 or AtNRT1.1) which is a dual-affinity nitrate transporter (Liu et al. 1999). AtNPF6.3 was also described as nitrate transceptor involved in the regula- tion of root architecture in response to nitrate signaling (Ho and Tsay 2010, Gojon et al. 2011) and in the primary response to nitrate (Ho et al. 2009, Wang et al. 2009).
The nitrate transporter 2 (NRT2) family is composed of seven members inA. thaliana. All the NRT2 functionally characterized to date are high-affinity nitrate transporters
[participating in the high-affinity transport system (HATS;
Orsel et al. 2002)]. The characterization of these trans- porters in planta, on the basis of tissue expression profiles and nitrate uptake experiments, showed that AtNRT2.1 is the major NRT2 transporter that participates in the high-affinity nitrate uptake, while AtNRT2.2 and AtNRT2.4 were found to play a minor role in nitrate uptake (Li et al. 2007, Kiba et al. 2012). Furthermore, AtNRT2.1 was shown to act as a repressor of lateral root initiation in nitrate uptake in an independent manner (Little et al. 2005). The mutants affected in AtNRT2.1 are insensitive to lateral root inhibition under high exter- nal sucrose and low external nitrate levels; therefore, the authors proposed that AtNRT2.1 acts as either a nitrate sensor or a signal transducer to coordinate root development with nutritional cues (Little et al. 2005).
Xenopusoocyte characterization of transporters shows that nitrate is the only substrate identified so far for NRT2, while a wide diversity of substrates can be transported by NPF (nitrate, nitrite, amino acids, peptides, glucosino- lates and hormones). Moreover, nitrate transport function of most NRT2 in higher plants depends on a small protein of about 200 amino acids, called NAR2 (or NRT3), which interacts directly with NRT2 (Yan et al. 2011, Krapp et al.
2014). Only AtNRT2.7 and OsNRT2.3b are exceptions and do not need NAR to transport nitrate (Chopin et al.
2007, Feng et al. 2011). Two NAR2 genes were char- acterized in A. thaliana and in Oryza sativa. In both species, only NAR2.1 has been shown to be necessary for the NRT2 proper functioning of the nitrate uptake (Orsel et al. 2006, Wirth et al. 2007, Feng et al. 2011). The NAR proteins show no catalytic activity or transport capacity.
However, it has been reported that AtNAR2.1 (AtNRT3.1) is strictly required for the expression and transport activ- ity of AtNRT2.1 (Orsel et al. 2006, Wirth et al. 2007).
Similar observations have been obtained in O. sativa in which OsNAR2.1 is strictly necessary for OsNRT2.1 transport activity (Feng et al. 2011).
To date, at the exception of a comprehensive study of nitrate transporters in Lotus japonicus (Criscuolo et al.
2012), these transporters have received little attention in legumes probably because these species are able to adapt N starvation by developing biological N2fixation in symbiotic nodules (Crespi and Frugier 2008). Still, it is important to study nitrate transport systems in legumes because this element plays a nutritional role and inter- venes as a signal in the regulation of root architecture (Morère-Le Paven et al. 2011) and nodulation (Streeter 1985a, 1985b, Barbulova et al. 2007). Legumes absorb mineral N and particularly nitrate at early stages of seedling establishment to fulfill their nutritional demand before functional symbiotic nodules are differentiated. In addition, during early stages of seedling establishment,
N supply was shown to modulate nodule initiation in L. japonicus by predisposing plants to successful or unsuccessful interactions with rhizobia prior to inoc- ulation (Omrane et al. 2009). The inhibitory effect of high exogenous N concentrations on the competence of plants to nodulate was maintained several days after transfer to low N concentration (Omrane et al. 2009).
Later during vegetative development, nitrate was shown to repress nodulation and N2 fixation activity (Streeter 1985a, 1985b, Day et al. 1989, Barbulova et al. 2007), involving both local and systemic regulatory pathways (Jeudy et al. 2010).
The search ofL. japonicusgenomic database revealed 92NPFgenes and 4NRT2genes but, up to now, none of them was functionally characterized as a nitrate trans- porter (Criscuolo et al. 2012, Léran et al. 2014). The Medicago truncatula genome sequencing and annota- tion have enabled identification of 80NPFgenes (Léran et al. 2014). This family is characterized by a large number of genes as inL. japonicusand in non-legume species, like A. thaliana (53 genes) and O. sativa (93 genes). In M. truncatula among the 80 NPF, only two proteins, named MtNPF6.8 and MtNPF1.7, were char- acterized as nitrate transporters in Xenopus oocytes (Morère-Le Paven et al. 2011, Bagchi et al. 2012). More than transporting nitrate, MtNPF1.7 is involved in the control of root growth by nitrate during seedling estab- lishment (Yendrek et al. 2010).
Compared with the NPF family, the NRT2 family is even less studied. For this reason, we took advantage of the progress in the model legumeM. truncatulagenome sequencing program to browse genomic database to identify putativeNRT2 genes. Although this family was described in the legume L. japonicus, it is of impor- tance to characterize it also inM. truncatula, a species selected by European and North American institutes of research as the model plant of agriculturally impor- tant legumes (Young et al. 2005). Six chromosomes of M. truncatula were sequenced in the US NSF-funded research projects, the chromosome 5 was sequenced in France with funds from the European Union jointly with funds from Genescope and INRA, and chromosome 3 was sequenced in the UK research council fundings (BBSRC (http://www.bbsrc.ac.uk/home/home.aspx); see http://www.jcvi.org/medicago/). Owing to the synteny betweenM. truncatulaand most members of agronomic interest of the large Papilionoid subfamily, genomic advances made inM. truncatulacan be extended to these species (Kaló et al. 2004, Young et al. 2005, Phan et al.
2007, Cruz-Izquierdo et al. 2012, Parra-González et al.
2012, Pottorff et al. 2012, Hyung et al. 2014).
Considering the importance of M. truncatula as a model plant, our aim in this work was to bring to the
scientific community, interested in legumes species, a molecular characterization of NRT2 and NAR2 gene families in order to allow further work that would unravel their potential involvement in nitrate absorption and more importantly in nitrate signaling under biological N2 fixation.
Materials and methods
Seed germination and seedling growth conditions TheM. truncatulaline used in this study was R108. Seed germination was performed as described previously (Morère-Le Paven et al. 2011), using N-free modified Murashige and Skoog medium (MS) containing 3 mM CaCl2, 1.5 mM MgSO4, 1.25 mM KH2PO4/K2HPO4, 5 mM KCl and complete micronutrients (Murashige and Skoog 1962). This medium was complemented with KNO3 as a sole nitrogen source at the concen- tration indicated for each individual experiment. The K+ concentration was adjusted to 5 mM by the addi- tion of KCl in all media with KNO3 concentrations lower than 5 mM. For gene expression analyses, eight plants were transferred 24 h after germination on filter paper with 7 mL of the appropriate solution in 12-cm2 transparent plates. Plates were placed at a 45∘ angle at 22∘C with a 8-h dark/16-h light illumination regime (120μmol m−2s−1) in a growth chamber. Samples were harvested after 5 h of light. For the light/dark rhythm response analysis, 7-day-old plants, grown on N-free modified MS medium, were harvested every 4 h during an 8-h/16-h dark–light regime.
Production of nodulated seedlings
Germinated seeds were grown in vitro on transparent plates for 7 days with N-free modified MS medium or complemented with 5 mM KNO3, as described pre- viously. Plants were transferred in vermiculite pots, placed in growth chamber and inoculated with 30 mL of Sinorhizobium meliloti (strain Sm2011) suspen- sion (OD600=0.05) in nutrient solution per pot. After 3 weeks, the nodules and the root system were separately collected for expression analysis.
Sequence analysis of theNRT2sandNAR2s
In silico NRT2 and NAR2 sequence search was per- formed using the BLAST algorithm of the NCBI data base (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the specific Medicago JCVI database Mt4.0 version (http://www.jcvi.org/medicago/) (Tang et al. 2014).
Sequence alignment of the deduced NRT2s and NAR2s amino acid sequences was performed using the BioEdit
free program withCLUSTALWmultiple alignment accessory application. A phylogenetic tree was constructed using the MEGA5program (Tamura et al. 2011). Predictions of the putative transmembrane (TM) spanning regions were obtained from the online program used by Araki and Hasegawa (2006). PSORT program was used to predict nitrate transporter localization (Nakai and Kanehisa 1992).
RNA extraction and reverse transcription
For total RNA extraction, frozen seedlings were crushed in liquid nitrogen with a mortar and pestle. The isola- tion of RNA was realized with the RNeasy plant mini kit (Qiagen, Venlo, Limbourg, the Netherlands) in accor- dance with manufacturer’s instructions. Two micrograms of RNA was treated for 3 min with 200 U of DNase I (Invitrogen, Carlsbad, CA). DNase was denatured for 8 min at 70∘C before reverse transcription. cDNAs were obtained by reverse transcription in an adequate buffer using 200 U of M-MLV Reverse Transcriptase (Promega, Madison, WI), 0.7μg of random primers (Invitrogen) and 0.2 mM of dNTP (Promega) in the presence of 40 U of a recombinant RNAsin ribonuclease inhibitor (Promega). Reaction occurred during 1 h at 37∘C in total volume of 50μL.
PCR and real-time quantitative PCR
Primers were designed using the Primer-Express soft- ware [Applied Biosystems, Foster City, CA (Table 1)].
For RT-PCR, cDNA amplification was carried out in an Icycler (Bio-Rad, Marne-La-Coquette, France) with a standard protocol (Tm=60∘C). Every reaction was performed using the GoTaq Flexi DNA Polymerase (Promega), strictly following manufacturer’s instructions, with 200 nM of each primer and 0.2 mM of dNTP (Promega) in a total reaction mixture of 20μL. The PCR consisted of a preliminary denaturation step of 4 min at 94∘C, followed by 28 cycles of 1 min at 94∘C, 45 s at 58∘C and 30 s at 72∘C, and a final elongation step of 10 min at 72∘C. The PCR products were visualized on ethidium bromide-stained 2% agarose gel.
For quantitative RT-PCR, the efficiency of the primer sets was evaluated by performing real-time PCR on sev- eral dilutions of a mix of the different first strands. Reac- tions took place on the light cycler ABI Prism 7000 SDS (Applied Biosystems). Every reaction was performed with 2.5μL of a 1/2 (v/v) dilution of the first cDNA strands using the GoTaq qPCR Master Mix (Promega), strictly following manufacturer’s instructions, with 200 nM of each primer in a total reaction mixture of 25μL. Reac- tion occurred during a 2-min incubation at 50∘C, then
Table 1.Sequences of primers used for quantitative RT-PCR. Fwd, forward primer; Rev, reverse primer.
Gene name Primer sequences
MtUbiquitin 10 Fwd: AAGCAGCAACTTCCCTGAAA Rev: GTATGGGTCGGAATCCAAAC
MtRBP1 Fwd: AGGGGCAAGTTCCTTCATTT
Rev: GGTAGAAGTGCTGGCTCAGG MtNRT2.1 Fwd: AAATACAACTCCTACCCACTAG
Rev: CAATATTAACTTATTAAAGCATGGG MtNRT2.2 Fwd: AAATACAACTCCTACCCACTAG
Rev: TCTTTAGGAAGATAAATAACTTTAC MtNRT2.3 Fwd: CAGCAGCACCACTTGTTCCTATAAT
Rev: GCAACACCGGCATTTCCT
10 min at 95∘C and followed by 40 cycles of 15 s at 95∘C and 1 min at 58∘C. The specificity of the PCR amplifi- cation procedure was checked with a heat-dissociation protocol (65–95∘C) after the final cycle of PCR. Each measurement was carried out with at least three inde- pendent biological replicates, using a triplicate PCR for determiningCtvalues. The ratio was calculated using an equation with normalization by mean of two endoge- nous reference genes,MtRPB1andMtUbiquitin10.
Statistical analysis
All statistical tests were performed using R version 2.13.0 statistical software (cran.r-project.org). For all data, appropriate statistical tests were carried out and are described in the legend of each figure.
Results
Identification ofNRT2andNAR2(NRT3) members ofM. truncatula
Four putative NRT2 sequences were obtained by homology search against the NCBI database and the specific Medicago JCVI database (accession num- bers: Medtr2g006730.1, Medtr4g057890.1, Medtr4g 057865.1 and Medtr8g069775.1). Medtr4g057890.1, Medtr4g057865.1 and Medtr8g069775.1 encode pre- dicted membrane proteins of 542 amino acids for the first two and 526 amino acids for the third one.
They belong to the nitrate/nitrite porter (NNP) family, a major facilitator superfamily (Pao et al. 1998). Despite a high-sequence homology with other nitrate trans- porters, it is unlikely thatMedtr2g006730.1 encodes a high-affinity nitrate transporter as it encodes a predicted protein consisting of only 100 amino acids. When comparing gene sequences (considering the introns and the exons), Medtr4g057890.1 and Medtr4g057865.1 differed only by four nucleotides. We have named the
predicted proteins MtNRT2.1 and MtNRT2.2 encoded by Medtr4g057890.1 and Medtr4g057865.1, respec- tively. Both proteins have the same amino acid sequence except the residue 352, which is leucine in MtNRT2.1 and isoleucine in MtNRT2.2 (Fig. S1, Supporting Infor- mation). TheMtNRT2.1andMtNRT2.2genes are located on chromosome 4 in a tail-to-tail orientation (Fig. 1A).
Both genes show the greatest homology with LjNRT2.1 ofL. japonicus with value of 89% and share also 78%
identity with AtNRT2.1 and AtNRT2.4 of A. thaliana and 74% identity with OsNRT2.1 and OsNRT2.2 ofO.
sativa. The predicted Medtr8g069775.1 protein, that we have named MtNRT2.3, is located on chromosome 8 (Fig. 1A) and shows the greatest homology with CM0161.180 of L. japonicus with value of 83% and shares also 71% with AtNRT2.5 ofA. thalianaand 62%
with OsNRT2.3a/b of O. sativa. MtNRT2.1/MtNRT2.2 and MtNRT2.3 share 57% identity and the three genes have two introns (Fig. 1B).
Hydrophobicity analysis predicted the presence of 11 TM spanning regions using TopPred or TMpred program or 12 TM spanning regions using MEMSAT3 or HMMTOP
program for the three MtNRT2s. Sequence alignments of the three MtNRT2s with all the NRT2 family mem- bers ofA. thaliana andO. sativawere performed using CLUSTALW multiple alignment application (Fig. S1). The middle regions of the proteins have high degrees of simi- larities, whereas N- and C-termini, which mostly consist of hydrophilic residues, share less homology within the family. The three putative MtNRT2s have the conserved amino acid motifs described by Okamoto et al. (2003).
In TM spanning region 5, like all characterized members of the NRT2 family, the threeMtNRT2shave a sequence, [AG]-G-W-G-[ND]-[ML]-G, which is highly related to a signature motif found in the NNP family (Trueman et al.
1996, Pao et al. 1998). Two other conserved sequences, R-P-x-G-G-x-x-S-D and [FY]-G-M-R-[GA]-R-L-W were found in all these NRT2 family members (Fig. S1).
Using the PSORTprogram, the predicted localization of MtNRT2.1, MtNRT2.2 and MtNRT2.3 was the plasma membrane.
Two NAR2(NRT3) genes were revealed in M. trun- catulaby a homology search against theMedicagoJCVI database, Medtr4g104730.1 and Medtr4g104700.1, named MtNAR2.1 and MtNAR2.2, respectively.
Both genes are located on chromosome 4 in a head-to-tail orientation (Fig. 1A). When comparing encoding sequences, the two genes differed only by 19 nucleotides. Predicted open reading frames of MtNAR2.1 and MtNAR2.2 encode 206 amino acids, both proteins sharing 97.5% identity (Fig. S2). These proteins show the greatest homology with AtNAR2.1 of A. thaliana, with value of only 50% identity and share
B
ATG STOP
MtNAR2.1 MtNAR2.2 MtNRT2.1 MtNRT2.2 MtNRT2.3
130 122
491 130
236 516
490 490 472
643 374
108
814 115 130 652
108
814 115 130 652
8 4
MtNRT2.1
MtNRT2.3 MtNRT2.2
MtNAR2.2 MtNAR2.1
A
Fig. 1.Locations and structures ofMtNRT2andMtNAR2genes inMedicago truncatulagenome. (A) Distribution and orientation ofMtNRT2and MtNAR2genes on chromosomes ofM. truncatula. The genes shown to the right of the chromosome are transcribed in the positive orientation (from the top down); the genes shown to the left of the chromosomes are transcribed in the negative orientation (from the bottom up). (B) Gene structure ofMtNRT2andMtNAR2gene families. Exons and introns of the genes are indicated by white and black boxes, respectively. The size of exons and introns is given in bp inside the boxes.
also 38% identity with OsNAR2.1 of O. sativa. Both genes have one intron (Fig. 1B).
Phylogenetic analyses were conducted for NRT2 pro- teins (Fig. 2A) and for NAR2 proteins (Fig. 2B). MtNRT2s are closely related to their counterparts in the legumeL.
japonicus; that is, MtNRT2.1 and MtNRT2.2 are close to LtNRT2.1 and LtNRT2.2 and MtNRT2.3 is close to CM0161.180 (Fig. 2A). When compared with charac- terized NRT2s ofA. thaliana, MtNRT2.1 and MtNRT2.2 were the closest to AtNRT2.1, AtNRT2.2 and AtNRT2.4, and the MtNRT2.3 was the closest to AtNRT2.5. The phy- logenetic tree of NAR2 proteins contains two distinct clusters, one for dicotyledonous and the other for mono- cotyledonous plants, with the two MtNAR2 proteins in the dicotyledonous cluster (Fig. 2B).
Tissue expression ofMtNRT2sandMtNAR2s in seedlings
As a preliminary experiment, expression ofMtNRT2.1, MtNRT2.2andMtNRT2.3was determined by quantita- tive RT-PCR in the roots and in the shoots of youngM.
truncatulaseedlings of two genotypes, A17 and R108 grown on 5 mM NO3−-supplied medium. Although MtNRT2.1 and MtNRT2.2 share 99.9% homology, using specific primers, that recognize the 3′ UTR region, allowed to successfully differentiate their expres- sions. If MtNRT2.1 and MtNRT2.3 were significantly
expressed, MtNRT2.2 exhibited a very faint expres- sion hardly detectable even by quantitative RT-PCR (data not shown). Since the profiles of gene expres- sion were similar in both genotypes, we decided to follow up our work on the genotype R108 that is gen- erally used for genetic transformation of M. truncatula and to focus only the expressions of MtNRT2.1 and MtNRT2.3.
Semi-quantitative and quantitative RT-PCR analyses were used to examine the transcription level of both MtNRT2 genes and bothMtNAR2genes in 10-day-old seedlings (Fig. 3). The expression of MtNRT2.1 was around 250 times higher in the root system than in the shoot part (Fig. 3A, B). Similarly, the expressions of NAR2.1 and NAR2.2 were, respectively, 70- and 250-fold higher in the root than that in the shoot. The expression of MtNRT2.3 was dramatically lower than that ofMtNRT2.1in the root (Fig. 3A). UnlikeMtNRT2.1, MtNRT2.3showed a low and similar expression in the root and the shoot (Fig. 3C). It is interesting to note that the expression level ofMtNAR2.1in the shoot was equivalent to that ofMtNRT2.3(Fig. 3A).
Expression of MtNRT2.1 and MtNRT2.3 was exam- ined in the primary and in the lateral roots, separately and also in different primary root sections (Fig. 4). The expression ofMtNRT2.1was 2.5-fold higher in the lateral roots than that in the primary roots (Fig. 4A). Inversely, the expression level ofMtNRT2.3was threefold higher
Medtr4g057890.1 (MtNRT2.1) Medtr4g057865.1 (MtNRT2.2) CM0649.30 (LjNRT2.1)
CM0649.40 (LjNRT2.2) AT5G60770 (AtNRT2.4) AT1G08090 (AtNRT2.1)
AT1G08100 (AtNRT2.2) AT5G60780 (AtNRT2.3) AT3G45060 (AtNRT2.6) AB008519 (OsNRT2.1) AK109733 (OsNRT2.2) U34290 (HvNRT2.2) AF091116 (HvNRT2.4) AF091115 (HvNRT2.3) U34198 (HvNRT2.1) AT1G12940 (AtNRT2.5) Medtr8g069775.1 (MtNRT2.3) CM0161.180 (Lj)
AK109776 (OsNRT2.3a) AK072215 (OsNRT2.3b)
Os01g3672 (OsNRT2.4) AT5G14570 (AtNRT2.7)
CM0001.20 (Lj)
0.1
A
B AAP31850 (HvNAR2.1)
AAP31851 (HvNAR2.3) AAP31852 (HvNAR2.2)
Os02g38230 (OsNAR2.1) Os04g40410 (OsNAR2.2) AT5G50200 (AtNAR2.1)
AT4G24720 (AtNAR2.2) Medtr4g104730.1 (MtNAR2.1)
Medtr4g104700.1 (MtNAR2.2) 0.1
Fig. 2. Phylogenetic analysis of NRT2 and NAR2 proteins. (A) NRT2 phylogenetic tree and (B) NAR2 phylogenetic tree. Evolutionary analyses were conducted in MEGA5 (Tamura et al. 2011).Medicago truncatula putative nitrate transporters are boxed. At,Arabidopsis thaliana; Hv, Hordeum vulgare; Lj,Lotus japonicus; Os,Oryza sativa. Scale of 0.1 corresponds to the number of amino acid substitutions per site.
in the primary roots than that in the lateral roots (Fig. 4B).
The expression pattern of bothMtNRT2genes along the primary root was examined in seedlings grown on 5 mM NO3−, before the lateral root emergence. The primary root was cut into four sections starting with the tip:
R1, R2 and R3 sections were 0.5 cm long and section R4 consisted of the rest of the root [around 2–3 cm in length (Fig. 4C, D)]. Expression ofMtNRT2.1was barely detectable in the root tip (R1), whereas expression increased homogeneously along the primary root and then decreased in R4 section (Fig. 4C). MtNRT2.3 was constitutively expressed along the primary root (Fig. 4D).
Expression of bothMtNRT2sandMtNAR2sduring light/dark rhythm and in response to nitrate MtNRT2andMtNAR2expression in the roots was mea- sured using 7-day-old seedlings grown on a N-free medium during a light/dark rhythm at a constant tem- perature (Fig. 5). MtNRT2.1 expression was increased after the first 4 h of the light period and peaked (approxi- mately sevenfold) after 8 h and then declined in the latter part of the day (Fig. 5A). In the same way, but offset than MtNRT2.1,MtNAR2.1expression was peaked (approx- imately fourfold) after 12 h of the light period and then declined in the latter part of the day (Fig. 5B). The expres- sion of MtNRT2.3andMtNAR2.2 in the roots was not submitted to the light/dark rhythm (Fig. 5A, B).
Expression of MtNRT2 and MtNAR2 in the roots was studied using 10-day-old seedlings grown on an N-free, an NO3−-supplied (0.25 or 5 mM) medium or a 5-mMNH4NO3-supplied medium (Fig. 6). In N-free condition, MtNRT2.3was more widely expressed than MtNRT2.1 (Fig. 6A). Expression of MtNRT2.1 in the roots was strongly induced by NO3−, at both low and high concentrations (approximately 150- and 600-fold, respectively, Fig. 6A, B). At the opposite, low and high nitrate supply did not regulate MtNRT2.3 expression in the same conditions (Fig. 6A, C). The comparison of plants grown on either NO3−- or NH4NO3-supplied medium showed that the expression of MtNRT2.1(and MtNRT2.3 to a lesser extent) was repressed by NH4+ supply (Fig. 6B, C). MtNAR2.1andMtNAR2.2 showed a very low level of expression under N-free (Fig. 6A) and 0.25 mMNO3−-supplied condition (Fig. 6D, E). The expression of bothMtNAR2genes was substantially stim- ulated by high nitrogen (5 mM) supplied either as NO3− alone or as NH4NO3(Fig. 6D, E). Interestingly, the induc- tion was more important when nitrogen was supplied as NH4NO3than when it was supplied as NO3−alone (Fig. 6D, E).
Expression of bothMtNRT2sandMtNAR2s in nodulating plants
The expression of MtNRT2.1 and MtNRT2.3 was also determined in the roots and in the mature nodules from 7-day-old seedlings inoculated during 3 weeks with S.
meliloti(Fig. 7). Unlike expression ofMtNRT2.3, expres- sion ofMtNRT2.1, MtNAR2.1andMtNAR2.2was also induced in the roots by NO3− (5 mM) at this develop- mental stage (Fig. 7B, D and E), as already shown previ- ously for 10-day-old seedlings (Fig. 6). The expression of both NRT2s and both NAR2s was detected in the mature nodules (Fig. 7A). On NO3−medium,MtNRT2.1 and to a lesser extent MtNAR2.1 andMtNAR2.2 were over-expressed in the roots compared with that in the
MtNRT2.1 MtNRT2.3
MtRBP1
Root Shoot
MtNAR2.1 MtNAR2.2
A
Relative expression
MtNRT2.1
0 100 200 300 400
Root Shoot
B MtNRT2.3
0 0.4 0.8 1.2 1.6
Root Shoot
C
Relative expression
MtNAR2.1
0 20 40 60 80 100
Root Shoot
D
Relative expression
MtNAR2.2
0 50 100 150 200 250 300 350
Root Shoot
E
Relative expression
*
* *
NS
Fig. 3.MtNRT2andMtNAR2expression in the roots and in the shoots.Medicago truncatulaseedlings were grown on 5 mMnitrate for 10 days.
(A) Semi-quantitative RT-PCR (28 cycles) used to detect the mRNA levels onMtNRT2.1,MtNRT2.3,MtNAR2.1andMtNAR2.2in the roots and in the shoots. The constitutive geneMtRBP1was used as a reference. (B)MtNRT2.1, (C)MtNRT2.3, (D)MtNAR2.1and (E)MtNAR2.2relative expression determined by quantitative RT-PCR. Error bars representSEof at least three independent biological replicates. Asterisks indicate significant differences between expression in the roots and in the shoots according to at-test (*P<0.01; NS, non-significant).
nodules (Fig. 7B, D and E). This trend was reversed for MtNRT2.3, which showed higher level of expression in the nodules than in the roots, irrespective of the growth medium (N-free or nitrate medium) (Fig. 7C).
Discussion
In silico characterization ofNRT2and ofNAR2 gene families inM. truncatula
The complete genome sequence and annotation of many higher plants have facilitated their molecular studies. All nitrate transporters NRT2 and NPF have been referenced notably inA. thaliana, O. sativaandL.
japonicus(Orsel et al. 2002, Araki and Hasegawa 2006, Criscuolo et al. 2012, Léran et al. 2014). In this work, an in silico approach was exploited using the latest v4 version of theMedicagogenome annotation (Tang et al.
2014) to identify the members of theNRT2family in the model legume species M. truncatula. In silico search revealed a small NRT2 gene family composed of four genes. Medtr2g006730.1 encodes a predicted protein consisting of 100 amino acids, which is too short to be a nitrate transporter. This result is strengthened by Cabeza
et al. (2014) who show that Medtr2g006730.1 (noted as Medtr2g085510.1 in previous data base) did not respond to nitrate. The three others, Medtr4g057890.1 (MtNRT2.1), Medtr4g057865.1 (MtNRT2.2) and Medtr8g069775.1 (MtNRT2.3), were predicted to encode proteins containing 12 TM spanning regions and highly conserved domains, which are the characteristics of NRT2 (Fig. 1). It is interesting to note thatMtNRT2.1 andMtNRT2.2are clustered in tandem as it is the case in A. thalianagenome forAtNRT2.1andAtNRT2.2(Orsel et al. 2002), in O. sativa genome for OsNRT2.1 and OsNRT2.2(Cai et al. 2008) and inL. japonicusgenome forLjNRT2.1andLjNRT2.2(Criscuolo et al. 2012).
Up to now only one high-affinity nitrate transporter corresponding to MtNRT2.1 was reported in M. trun- catula, either in transcriptomic analyses in response to nitrate (Ruffel et al. 2008, Cabeza et al. 2014) or in an evolutionary classification of nitrate transporters in 20 land plants (von Wittgenstein et al. 2014). Based on our study, it appears thatNRT2 family ofM. truncatula is composed of at least three members, that is a small family of genes, similar however to the size of NRT2 families in legume or non-legume species characterized
C
0 0.4 0.8 1.2 R1
R2 R3 R4
Relative expression a b
b c
0 0.4 0.8 1.2 Relative expression
D
a a
b b 0
0.4 0.8 1.2
B MtNRT2.3
Relative expression
*
0 1 2 3
Primary root
Lateral roots
Relative expression
A MtNRT2.1
**
Primary root
Lateral roots
Fig. 4.MtNRT2.1andMtNRT2.3expression pattern in different parts of the root system. (A)MtNRT2.1and (B)MtNRT2.3relative expression in primary and lateral roots from seedlings grown on 5 mMnitrate for 10 days. (C)MtNRT2.1and (D)MtNRT2.3relative expression from four sequential sections of the primary root (from seedlings grown on 5 mM nitrate for 6 days) starting with the tip (R1) followed by root sections R2 and R3 (0.5 cm long) and the root remainder R4. The R3 section was used as the calibrator. Error bars representSEof three independent biological replicates. Asterisks indicate significant differences between relative expression in primary root and in lateral roots according to a t-test (*P<0.05, **P<0.01). The letters define significant differences according to a Waller–Duncan test.
so far: four genes inL. japonicus(Criscuolo et al. 2012), seven genes in A. thaliana (Orsel et al. 2002), and four genes inO. sativa (Araki and Hasegawa 2006). In all these species, the NRT2 family is smaller than the NPF family which counts 80 genes in M. truncatula and 53, 93 and 92 in A. thaliana, O. sativa and L.
japonicus, respectively (Léran et al. 2014). This could be explained by the diversity of substrates transported by NPF members compared with NRT2 for which no substrate other than nitrate has been identified so far. It is interesting to note that among the NPF family members inM. truncatula, MtNPF1.7 (LATD-NIP) is a high-affinity nitrate transporter (Bagchi et al. 2012). Nitrate trans- port in the high-affinity range can also be achieved by transporters bearing dual-affinity as described in A. thaliana (Liu et al. 1999) and M. truncatula (Morère-Le Paven et al. 2011).
At the exception of AtNRT2.7 and OsNRT2.3b, transport activities of all the NRT2s studied so far depend on NAR2 proteins. For this reason, we were interested in the characterization of NAR2 family in
M. truncatula. In silico search revealed a NAR2 gene family composed of two genes (Medtr4g104730.1 and Medtrg104700.1 named MtNAR2.1 and MtNAR2.2, respectively); two genes were also described in A.
thaliana and in O. sativa (Okamoto et al. 2003, Cai et al. 2008). The genomic sequences revealed that the two NAR2 genes of M. truncatula are closely located on chromosome 4 whereas the two genes of O. sativa are located on two different chromosomes (Cai et al.
2008). Furthermore, MtNAR2.1 and MtNAR2.2 have an intron of the same size and encode proteins sharing 97.5% identity, suggesting that they have derived from a duplication event. It is worth to note that NAR2 proteins ofA. thalianaandO. sativashare only 62.2 and 61.2%
identity, respectively, and only NAR2.1 has been shown to be necessary for the NRT2 functioning of the nitrate uptake in A. thaliana andO. sativa (Orsel et al. 2006, Feng et al. 2011). Consistent with this observation, the very high percentage of identity between MtNAR2.1 and MtNAR2.2 can be regarded as an indication that both NAR2 proteins are involved in NRT2 functioning inM. truncatula.
Molecular characterization ofNRT2gene family inM. truncatula
The three NRT2 genes revealed by the in silico study showed contrasted profiles of expression in terms of organ specificity and regulation. Consistent with the observation of the expression profiles of the two par- alogs LjNRT2.1 and LjNRT2.2 (Criscuolo et al. 2012) and AtNRT2.1 and AtNRT2.2 (Orsel et al. 2002), the two paralogsMtNRT2.1andMtNRT2.2were differently expressed. OnlyMtNRT2.1was significantly expressed during early vegetative stages of development as well as in nodulating plants. In A. thaliana, it is only when AtNRT2.1 is mutated that the level of expression of AtNRT2.2 increases, probably to compensate for the functional loss of AtNRT2.1 (Li et al. 2007). Similarly, inL. japonicusit was proposed that a nitrate-inducible LjNRT2.2 profile of expression could be revealed only in knockout Ljnrt2.1 mutants. Thus, it is conceivable that MtNRT2.2 may be revealed in mutants deprived of the expression of MtNRT2.1. The other possibility not to be ruled out at this stage of investigation is that MtNRT2.2expression may be confined to reproductive organs, flowers or seeds.
MtNRT2.1is not expressed in the shoots (Fig. 3); how- ever, it is characterized by a very high level of expression in the root system. In young seedlings, its expression level is the highest in the primary root sections above the tip (R2 and R3; Fig. 4), and in older plants, it was also expressed in lateral roots. Given that MtNRT2.1
0 1 2 3 4 5 6 7 8 9
0 4 8 12 16 20 24
MtNRT2.1 MtNRT2.3
Relative expression
A
(h)
0 1 2 3 4 5 6 7 8 9
0 4 8 12 16 20 24
MtNAR2.1 MtNAR2.2
Relative expression
B
(h)
*
*
Fig. 5.MtNRT2andMtNAR2expression during light/dark rhythm inMedicago truncatularoots. Diurnal changes in expression of (A)MtNRT2and (B) MtNAR2. Plants were grown under an 8-h/16-h dark–light regime on N-free medium in vertical plates for 7 days. Total RNA was isolated from roots before light starts (0); after 4, 8, 12 or 16 h of light; and after 4 h of dark. Error bars representSEof three independent biological replicates. Asterisks indicate significant differences with the (0 h) point according to a one-wayANOVAtest (*P<0.001).
is expressed at a very low level under N-free medium and showed an increased level of expression with the increase in exogenous nitrate concentration from 0.25 to 5 mM(Fig. 6), it is a nitrate-inducible gene. It is how- ever important to note that, in plants inoculated withS.
meliloti,MtNRT2.1was still responsive to nitrate as it was induced in the roots although it was poorly expressed in the nodules (Fig. 7). The addition of ammonium in the nutrient solution resulted in the decrease inMtNRT2.1 expression level (Fig. 6), suggesting a feedback inhibition by the products of nitrate metabolism, ammonium per se or amino acids derived from ammonium assimilation.
Similarly, the expression of the gene encoding nitrate reductase, a key enzyme in N metabolism, was found negatively regulated by glutamine (Deng et al. 1990).
The control of nitrate uptake by nitrate as an inducer and by reduced nitrogen as a negative regulator is a characteristic of nitrogen transport and assimilation sys- tems that allow the plants to adapt nitrogen metabolism to the photosynthetic activity as the provider of carbon skeletons and energy (ATP and reducing power). Con- sistently,MtNRT2.1showed a modulation of expression through the light/dark rhythm (Fig. 5). The expression level increased during the light period with a peak of expression after 8 h of illumination and a very low level of expression in the dark. This mode of regulation was observed for the two systems of nitrate transport inA.
thaliana(Lejay et al. 1999) and for the reduction of nitrate by nitrate reductase in various species such as tobacco (Galangau et al. 1988, Deng et al. 1990), A. thaliana (Pilgrim et al. 1993) and tomato (Tucker et al. 2004). The increase in the expression ofMtNRT2.1during the first hour of the day could be due to a stimulating effect of
photosynthates transported from the shoots. Indeed, it has been reported that sucrose supply prevented the inhi- bition ofAtNRT2.1andAtNPF6.3expressions in the dark (Lejay et al. 1999).
From these results, it appears that the regulation of the expression of MtNRT2.1 is very similar to that of AtNRT2.1 that accounts for 60% of totalNRT2mRNA in A. thaliana roots (Orsel et al. 2002, Nazoa et al.
2003, Muños et al. 2004, Remans et al. 2006). Nitrate uptake experiments showed that AtNRT2.1 is the major contributor to the HATS activity in A. thaliana (Filleur et al. 2001, Krouk et al. 2006). Furthermore, AtNAR2.1 is strictly required for the transport activity of AtNRT2.1 (Orsel et al. 2006, Wirth et al. 2007). Altogether, the spatial expression profiles, the regulation characteris- tics of MtNRT2.1, the coincidence of the expression of MtNAR2.1 and MtNAR2.2 with that ofMtNRT2.1and the size of the encoded protein with 12 TM spanning regions strongly support the idea that MtNRT2.1 is a nitrate transporter with a major contribution to the HATS activity inM. truncatula.
MtNRT2.3 is characterized by a constitutive expres- sion profile (Figs 3 and 4). Other major difference between MtNRT2.3 and MtNRT2.1 resides in the fact that MtNRT2.3 expression is nitrate independent (Fig. 6);
it is not responsive to light/dark rhythm (Fig. 5) and is expressed in the shoots and in the nodules (Figs 3 and 7). In the organs where both genes were expressed, MtNRT2.3expression level was significantly lower than that of MtNRT2.1 in primary root and lateral roots of young seedlings. Obviously, the physiological functions of MtNRT2.3 implied by the profile of expression of the encoding gene might be different from those of
MtNRT2.1 MtNRT2.3
MtRBP1 MtNAR2.1 MtNAR2.2
N-free 5 mM NO3–
0 100 200 300 400 500 600 700
N-free NO3– 0.25 mM
NO3– 5 mM
NH4NO3 5 mM
Relative expression
B MtNRT2.1
a b
b c
C
0 0.5 1.0 1.5
N-free NO3– 0.25 mM
NO3– 5 mM
NH4NO3 5 mM
Relative expression
MtNRT2.3
a a
a
a
MtNAR2.1
0 5 10 15 20 25
N-free NO3– 0.25 mM
NO3– 5 mM
NH4NO3 5 mM
D
Relative expression
a a
b
c MtNAR2.2
0 5 10 15 20 25
Relative expression
N-free NO3– 0.25 mM
NO3– 5 mM
NH4NO3 5 mM
E
a a
b c
A
Fig. 6.Effect of nitrate treatment on expression of bothMtNRT2and bothMtNAR2in the roots. (A) mRNA levels of bothMtNRT2and bothMtNAR2 genes determined by semi-quantitative RT-PCR analysis (28 cycles). The constitutive geneMtRBP1was used as a reference. (B)MtNRT2.1, (C)MtNRT2.3, (D)MtNAR2.1and (E)MtNAR2.2relative expression determined using quantitative RT-PCR. Seedlings were grown on N-free medium, or complemented with 0.25 or 5 mMof nitrate, or with 5 mMof NH4NO3for 10 days. Error bars represent theSEof three independent biological replicates. The letters define significant differences according to a Waller–Duncan test.
MtNRT2.1andMtNRT2.2. The expression ofMtNRT2.3 in both roots and shoots, similarly to that observed in rice for OsNRT2.3, suggests a role in the transport of nitrate inside the plant from the root to the shoot (Feng et al. 2011). The expression ofMtNRT2.3 in the nodules is not intriguing as the expression of several genes encoding nitrate transporters was associated with various post-inoculation processes occurring in the roots and in the nodules of L. japonicus and M.
truncatula. Two putative low-affinity nitrate transporters of L. japonicus, CM0608.1290 and CM08626.370, were highly expressed in young and mature nodules (Criscuolo et al. 2012). The M. truncatula LATD/NIP (MtNPF1.7) has been reported to be involved in nod- ule development (Yendrek et al. 2010). Among genes belonging toLjNRT2family, three of four were respon- sive to symbiotic interaction between Mesorhizobium lotiandL. japonicus(Criscuolo et al. 2012). IfLjNRT2.1 was dramatically downregulated in inoculated roots and nodules,LjNRT2.2showed a transient stimulation at 24 h post-inoculation in inoculated roots without, however, being expressed in nodules. The most interesting profile
is that ofCM0001.20that was induced in the inoculated roots at 72 h post-inoculation followed by a burst of expression in young and mature nodules (Criscuolo et al. 2012). Similar to MtNRT2.3, CM0001.20 is the one of the four members ofNRT2family inL. japonicus that is not responsive to nitrate supply. When these observations are considered altogether, they suggest the involvement of nitrate transporters, MtNRT2.3 in M.
truncatulaand CM0001.20 inL. japonicus, in nitrate sig- naling pathways controlling post-inoculation processes that govern nodule formation, development and/or functioning. However, the expression ofMtNAR2in the nodule suggests that a nitrate transport activity in the nodule ofM. truncatulavia MtNAR2/MtNRT2.3 system is not to be ruled out.
Conclusion
Browsing the latest version of theM. truncatulagenome annotation v4 version (Tang et al. 2014) revealed three putative NRT2 members with only two signif- icantly expressed genes MtNRT2.1 and MtNRT2.3,
0 10 20 30 40 50 60
Roots Nodules Roots Nodules N-free 5 mM NO3–
MtNRT2.1
B
Relative expression
*
NS
MtNAR2.1
0 1 2 3 4
Roots Nodules Roots Nodules
Relative expression
D
N-free 5 mM NO3–
*
*
0 1 2 3 4 5 6 7
N-free 5 mM NO3– MtNRT2.3
C
Relative expression
Roots Nodules Roots Nodules
* *
MtNAR2.2
0 1 2 3
Roots Nodules Roots Nodules
Relative expression
E
N-free 5 mM NO3–
NS
*
Roots Nodules MtNRT2.1
MtNRT2.3
MtRBP1 MtNAR2.1 MtNAR2.2
A 5 mM NO3–
Fig. 7. Transcriptional response of bothMtNRT2and bothMtNAR2expression toSinorhizobium melilotiinoculation.Medicago truncatulaseedlings were grown on N-free medium or complemented with 5 mMnitrate for 7 days before inoculation byS. melilotistrainSm2011. Relative expression of genes in the root system and in the nodules was evaluated at 21 days post-inoculation. (A) mRNA levels of bothMtNRT2and bothMtNART2genes determined using semi-quantitative RT-PCR (28 cycles) in the root system and in the nodules of plants grown on 5 mMnitrate. The constitutive gene MtRBP1was used as a reference. (B)MtNRT2.1, (C)MtNRT2.3, (D)MtNAR2.1and (E)MtNAR2.2relative expression determined using quantitative RT-PCR. The roots from plants grown on N-free medium were used as the calibrator for roots and nodules of both conditions. Roots and nodules were harvested at the same time. Error bars representSEof three independent biological replicates. Asterisks indicate significant differences between relative expression in root system and in nodules according to at-test (*P<0.07).
and two putative NAR2 genes. The contrasted pro- files of expression and regulation of MtNRT2.1 and MtNRT2.3 rule out redundancy in putative functions of the encoded proteins.MtNRT2.1 exhibited a typical profile of expression of a transporter playing major role in nitrate uptake from the soil similarly toAtNRT2.1in A. thaliana.MtNRT2.3 expression profile suggested an involvement of the encoded protein in nitrate transport inside the plant and/or an involvement in nitrate signal- ing pathways controlling processes such as biological N2fixation.
Authors’ contributions
A. P., A. M. L. and M. C. M. L. P. designed, and A. P.
and T. C. performed the research; A. P., E. P., A. M. L. and M. C. M. L. P. analyzed the data; A. P., E. P., A. M. L. and M. C. M. L. P. wrote the manuscript.
Acknowledgements –The QUALISEM program funded by Région Pays de Loire (France) supported this work. A. P.
is grateful to ‘Angers Loire Métropole’ for funding his fellowship.
References
Araki R, Hasegawa H (2006) Expression of rice (Oryza sativaL.) genes involved in high-affinity nitrate transport during the period of nitrate induction. Breed Sci 56:
295–302
Bagchi R, Salehin M, Adeyemo OS, Salazar C, Shulaev V, Sherrier DJ, Dickstein R (2012) Functional assessment of theMedicago truncatulaNIP/LATD protein demonstrates that it is a high-affinity nitrate transporter. Plant Physiol 160: 906–916
Barbulova A, Rogato A, D’Apuzzo E, Omrane S, Chiurazzi M (2007) Differential effects of combined N sources on early steps of the Nod factor-dependent transduction
pathway inLotus japonicus. Mol Plant Microbe Interact 20: 994–1003
Cabeza R, Koester B, Liese R, Lingner A, Baumgarten V, Dirks J, Salinas-Riester G, Pommerenke C, Dittert K, Schulze J (2014) An RNA sequencing transcriptome analysis reveals novel insights into molecular aspects of the nitrate impact on the nodule activity ofMedicago truncatula. Plant Physiol 164: 400–411
Cai C, Wang JY, Zhu YG, Shen QR, Li B, Tong YP, Li ZS (2008) Gene structure and expression of the high-affinity nitrate transport system in rice roots. J Integr Plant Biol 50: 443–451
Chopin F, Orsel M, Dorbe MF, Chardon F, Truong HN, Miller AJ, Krapp A, Daniel-Vedele F (2007) The ArabidopsisATNRT2.7 nitrate transporter controls nitrate content in seeds. Plant Cell 19: 1590–1602 Crespi M, Frugier F (2008)De novoorgan formation from
differentiated cells: root nodule organogenesis. Sci Signal 1: re11
Criscuolo G, Valkov VT, Parlati A, Alves LM, Chiurazzi M (2012) Molecular characterization of theLotus japonicus NRT1(PTR) and NRT2 families. Plant Cell Environ 35:
1567–1581
Cruz-Izquierdo S, Avila CM, Satovic Z, Palomino C, Gutierrez N, Ellwood SR, Phan HT, Cubero JI, Torres AM (2012) Comparative genomics to bridgeVicia fabawith model and closely-related legume species: stability of QTLs for flowering and yield-related traits. Theor Appl Genet 125: 1767–1782
Day DA, Carroll BJ, Delves AC, Gresshoff PM (1989) Relationship between autoregulation and nitrate inhibition of nodulation in soybeans. Physiol Plant 75:
37–42
Deng MD, Moureaux T, Leydecker MT, Caboche M (1990) Nitrate-reductase expression is under the control of a circadian rhythm and is light inducible inNicotiana tabacumleaves. Planta 180: 257–261
Feng H, Yan M, Fan X, Li B, Shen Q, Miller AJ, Xu G (2011) Spatial expression and regulation of rice high-affinity nitrate transporters by nitrogen and carbon status. J Exp Bot 62: 2319–2332
Filleur S, Dorbe MF, Cerezo M, Orsel M, Granier F, Gojon A, Daniel-Vedele F (2001) AnArabidopsisT-DNA mutant affected inNrt2genes is impaired in nitrate uptake. FEBS Lett 489: 220–224
Galangau F, Daniel-Vedele F, Moureaux T, Dorbe MF, Leydecker MT, Caboche M (1988) Expression of leaf nitrate reductase genes from tomato and tobacco in relation to light–dark regimes and nitrate supply. Plant Physiol 88: 383–388
Gojon A, Krouk G, Perrine-Walker F, Laugier E (2011) Nitrate transceptor(s) in plants. J Exp Bot 62: 2299–2308 Ho CH, Tsay YF (2010) Nitrate, ammonium, and
potassium sensing and signaling. Curr Opin Plant Biol 13: 604–610
Ho CH, Lin SH, Hu HC, Tsay YF (2009) CHL1 functions as a nitrate sensor in plants. Cell 138: 1184–1194
Hyung D, Lee C, Kim JH, Yoo D, Seo YS, Jeong SC, Lee JH, Chung Y, Jung KH, Cook DR, Choi HK (2014)
Cross-family translational genomics of abiotic stress-responsive genes betweenArabidopsisand Medicago truncatula. PLoS One 9: e91721
Jeudy C, Ruffel S, Freixes S, Tillard P, Santoni AL, Morel S, Journet EP, Duc G, Gojon A, Lepetit M, Salon C (2010) Adaptation ofMedicago truncatulato nitrogen limitation is modulated via local and systemic nodule
developmental responses. New Phytol 185: 817–828 Kaló P, Seres A, Taylor SA, Jakab J, Kevei Z, Kereszt A,
Endre G, Ellis TH, Kiss GB (2004) Comparative mapping betweenMedicago sativaandPisum sativum. Mol Genet Genomics 272: 235–246
Kiba T, Feria-Bourrellier AB, Lafouge F, Lezhneva L, Boutet-Mercey S, Orsel M, Bréhaut V, Miller A, Daniel-Vedele F, Sakakibara H, Krapp A (2012) The Arabidopsisnitrate transporter NRT2.4 plays a double role in roots and shoots of nitrogen-starved plants. Plant Cell 24: 245–258
Krapp A, David LC, Chardin C, Girin T, Marmagne A, Leprince AS, Chaillou S, Ferrario-Méry S, Meyer C, Daniel-Vedele F (2014) Nitrate transport and signalling inArabidopsis. J Exp Bot 65: 789–798
Krouk G, Tillard P, Gojon A (2006) Regulation of the high-affinity NO3−uptake system by NRT1.1-mediated NO3−demand signaling inArabidopsis. Plant Physiol 142: 1075–1086
Lejay L, Tillard P, Lepetit M, Olive F, Filleur S, Daniel-Vedele F, Gojon A (1999) Molecular and functional regulation of two NO3−uptake systems by N- and C-status ofArabidopsisplants. Plant J 18: 509–519 Léran S, Varala K, Boyer JC, Chiurazzi M, Crawford N,
Daniel-Vedele F, David L, Dickstein R, Fernandez E, Forde B, Gassmann W, Geiger D, Gojon A, Gong JM, Halkier BA, Harris JM, Hedrich R, Limami AM, Rentsch D, Seo M, Tsay YF, Zhang M, Coruzzi G, Lacombe B (2014) A unified nomenclature of NITRATE
TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants. Trends Plant Sci 19: 5–9
Li W, Wang Y, Okamoto M, Crawford NM, Siddiqi MY, Glass AD (2007) Dissection of theAtNRT2.1:AtNRT2.2 inducible high-affinity nitrate transporter gene cluster.
Plant Physiol 143: 425–433
Little DY, Rao H, Oliva S, Daniel-Vedele F, Krapp A, Malamy JE (2005) The putative high-affinity nitrate transporter NRT2.1 represses lateral root initiation in response to nutritional cues. Proc Natl Acad Sci USA 102: 13693–13698
Liu KH, Huang CY, Tsay YF (1999) CHL1 is a dual-affinity nitrate transporter ofArabidopsisinvolved in multiple phases of nitrate uptake. Plant Cell 11: 865–874
Morère-Le Paven MC, Viau L, Hamon A, Vandecasteele C, Pellizzaro A, Bourdin C, Laffont C, Lapied B, Lepetit M, Frugier F, Legros C, Limami AM (2011) Characterization of a dual-affinity nitrate transporter MtNRT1.3 in the model legumeMedicago truncatula. J Exp Bot 62:
5595–5605
Muños S, Cazettes C, Fizames C, Gaymard F, Tillard P, Lepetit M, Lejay L, Gojon A (2004) Transcript profiling in the chl1-5 mutant ofArabidopsisreveals a role of the nitrate transporter NRT1.1 in the regulation of another nitrate transporter, NRT2.1. Plant Cell 16: 2433–2447 Murashige T, Skoog F (1962) A revised medium for rapid
growth and bio assays with tobacco tissue cultures.
Physiol Plant 15: 473–497
Nacry P, Bouguyon E, Gojon A (2013) Nitrogen acquisition by roots: physiological and developmental mechanisms ensuring plant adaptation to a fluctuating resource. Plant Soil 370: 1–29
Nakai K, Kanehisa M (1992) A knowledge base for predicting protein localization sites in eukaryotic cells.
Genomics 14: 897–911
Nazoa P, Vidmar JJ, Tranbarger TJ, Mouline K, Damiani I, Tillard P, Zhuo D, Glass AD, Touraine B (2003) Regulation of the nitrate transporter geneAtNRT2.1in Arabidopsis thaliana: responses to nitrate, amino acids and developmental stage. Plant Mol Biol 52: 689–703 Okamoto M, Vidmar JJ, Glass AD (2003) Regulation of
NRT1andNRT2gene families ofArabidopsis thaliana:
responses to nitrate provision. Plant Cell Physiol 44:
304–317
Omrane S, Ferrarini A, D’Apuzzo E, Rogato A, Delledonne M, Chiurazzi M (2009) Symbiotic competence inLotus japonicusis affected by plant nitrogen status:
transcriptomic identification of genes affected by a new signalling pathway. New Phytol 183: 380–394 Orsel M, Krapp A, Daniel-Vedele F (2002) Analysis of the
NRT2 nitrate transporter family inArabidopsis. Structure and gene expression. Plant Physiol 129: 886–896 Orsel M, Chopin F, Leleu O, Smith SJ, Krapp A,
Daniel-Vedele F, Miller AJ (2006) Characterization of a two-component high-affinity nitrate uptake system in Arabidopsis. Physiology and protein–protein interaction. Plant Physiol 142: 1304–1317 Pao SS, Paulsen IT, Saier MH (1998) Major facilitator
superfamily. Microbiol Mol Biol Rev 62: 1–34 Parra-González LB, Aravena-Abarzúa GA,
Navarro-Navarro CS, Udall J, Maughan J, Peterson LM, Salvo-Garrido HE, Maureira-Butler IJ (2012) Yellow lupin (Lupinus luteusL.) transcriptome sequencing:
molecular marker development and comparative studies. BMC Genomics 13: 425
Phan HT, Ellwood SR, Adhikari K, Nelson MN, Oliver RP (2007) The first genetic and comparative map of white lupin (Lupinus albusL.): identification of QTLs for
anthracnose resistance and flowering time, and a locus for alkaloid content. DNA Res 14: 59–70
Pilgrim ML, Caspar T, Quail PH, McClung CR (1993) Circadian and light-regulated expression of nitrate reductase inArabidopsis. Plant Mol Biol 23: 349–364 Pottorff M, Ehlers JD, Fatokun C, Roberts PA, Close TJ
(2012) Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species. BMC Genomics 13: 234
Remans T, Nacry P, Pervent M, Girin T, Tillard P, Lepetit M, Gojon A (2006) A central role for the nitrate transporter NRT2.1 in the integrated morphological and physiological responses of the root system to nitrogen limitation inArabidopsis. Plant Physiol 140: 909–921 Ruffel S, Freixes S, Balzergue S, Tillard P, Jeudy C,
Martin-Magniette M, van der Merwe MJ, Kakar K, Gouzy J, Fernie AR, Udvardi M, Salon C, Gojon A, Lepetit M (2008) Systemic signaling of the plant nitrogen status triggers specific transcriptome responses
depending on the nitrogen source inMedicago truncatula. Plant Physiol 146: 2020–2035
Streeter JG (1985a) Nitrate inhibition of legume nodule growth and activity : I. Long term studies with a continuous supply of nitrate. Plant Physiol 77: 321–324 Streeter JG (1985b) Nitrate inhibition of legume nodule
growth and activity: II. Short term studies with high nitrate supply. Plant Physiol 77: 325–328
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739
Tang H, Krishnakumar V, Bidwell S, Rosen B, Chan A, Zhou S, Gentzbittel L, Childs KL, Yandell M, Gundlach H, Mayer KF, Schwartz DC, Town CD (2014) An improved genome release (version Mt4.0) for the model legumeMedicago truncatula. BMC Genomics 15: 312 Trueman LJ, Richardson A, Forde BG (1996) Molecular
cloning of higher plant homologues of the high-affinity nitrate transporters ofChlamydomonas reinhardtiiand Aspergillus nidulans. Gene 175: 223–231
Tucker DE, Allen DJ, Ort DR (2004) Control of nitrate reductase by circadian and diurnal rhythms in tomato.
Planta 219: 277–285
Wang R, Xing X, Wang Y, Tran A, Crawford N (2009) A genetic screen for nitrate regulatory mutants captures the nitrate transporter geneNRT1.1. Plant Physiol 151:
472–478
Wirth J, Chopin F, Santoni V, Viennois G, Tillard P, Krapp A, Lejay L, Daniel-Vedele F, Gojon A (2007) Regulation of root nitrate uptake at the NRT2.1 protein level in Arabidopsis thaliana. J Biol Chem 282: 23541–23552
von Wittgenstein NJJB, Le CH, Hawkins BJ, Ehlting J (2014) Evolutionary classification of ammonium, nitrate, and peptide transporters in land plants. BMC Evol Biol 14: 11 Yan M, Fan X, Feng H, Miller AJ, Shen Q, Xu G (2011) Rice
OsNAR2.1 interacts with OsNRT2.1, OsNRT2.2 and OsNRT2.3a nitrate transporters to provide uptake over high and low concentration ranges. Plant Cell Environ 34: 1360–1372
Yendrek CR, Lee YC, Morris V, Liang Y, Pislariu CI, Burkart G, Meckfessel MH, Salehin M, Kessler H, Wessler H, Lloyd M, Lutton H, Teillet A, Sherrier DJ, Journet EP, Harris JM, Dickstein R (2010) A putative transporter is essential for integrating nutrient and hormone signaling with lateral root growth and nodule development in Medicago truncatula. Plant J 62: 100–112
Young ND, Cannon SB, Sato S, Kim D, Cook DR, Town CD, Roe BA, Tabata S (2005) Sequencing the
genespaces ofMedicago truncatulaandLotus japonicus.
Plant Physiol 137: 1174–1181
Supporting Information
Additional Supporting Information may be found in the online version of this article:
Fig. S1.Amino acid sequence alignment of the putative Medicago truncatula MtNRT2.1,MtNRT2.2and free pro- gram with CLUSTALWmultiple alignment accessory appli- cation. Shaded regions show an amino acid sequence homology of at least 75% between the sequences; gaps generated in the alignment are indicated by hyphens. The conserved regions are enclosed in black boxes.
Fig. S2.Amino acid sequence alignment of the putative Medicago truncatula MtNAR2.1,MtNAR2.2with NAR2 of Arabidopsis thaliana, Hordeum vulgare and Oryza sativa. The alignment was obtained as described in the legend of supplemental Fig. S1.
Edited by J. K. Schjørring