Article
Reference
SLP-2 negatively modulates mitochondrial sodium-calcium exchange
DA CRUZ, Sandrine, et al.
Abstract
Mitochondria play a major role in cellular calcium homeostasis. Despite decades of studies, the molecules that mediate and regulate the transport of calcium ions in and out of the mitochondrial matrix remain unknown. Here, we investigate whether SLP-2, an inner membrane mitochondrial protein of unknown function, modulates the activity of mitochondrial Ca(2+) transporters. In HeLa cells depleted of SLP-2, the amplitude and duration of mitochondrial Ca(2+) elevations evoked by agonists were decreased compared to control cells. SLP-2 depletion increased the rates of calcium extrusion from mitochondria. This effect disappeared upon Na(+) removal or addition of CGP-37157, an inhibitor of the mitochondrial Na(+)/Ca(2+) exchanger, and persisted in permeabilized cells exposed to a fixed cytosolic Na(+) and Ca(2+) concentration. The rates of mitochondrial Ca(2+) extrusion were prolonged in SLP-2 over-expressing cells, independently of the amplitude of mitochondrial Ca(2+) elevations. The amplitude of cytosolic Ca(2+) elevations was increased by SLP-2 depletion and decreased by SLP-2 over-expression. These data show that SLP-2 [...]
DA CRUZ, Sandrine, et al . SLP-2 negatively modulates mitochondrial sodium-calcium exchange. Cell Calcium , 2010, vol. 47, no. 1, p. 11-18
DOI : 10.1016/j.ceca.2009.10.005 PMID : 19944461
Available at:
http://archive-ouverte.unige.ch/unige:18371
Disclaimer: layout of this document may differ from the published version.
1 / 1
Contents lists available atScienceDirect
Cell Calcium
j o u r n a l h o m e p a g e :w w w . e l s e v i e r . c o m / l o c a t e / c e c a
SLP-2 negatively modulates mitochondrial sodium–calcium exchange
Sandrine Da Cruz
a,1,2, Umberto De Marchi
b,1, Maud Frieden
b, Philippe A. Parone
a,2, Jean-Claude Martinou
a, Nicolas Demaurex
b,∗aDepartment of Cell Biology, University of Geneva, Switzerland
bDepartment of Cell Physiology and Metabolism, University of Geneva, 1 Michel-Servet, CH-1211 Geneva 4, Switzerland
a r t i c l e i n f o
Article history:
Received 24 June 2009
Received in revised form 27 October 2009 Accepted 30 October 2009
Available online 26 November 2009
Keywords:
Mitochondria Calcium signaling Sodium–calcium exchange Stomatin
a b s t r a c t
Mitochondria play a major role in cellular calcium homeostasis. Despite decades of studies, the molecules that mediate and regulate the transport of calcium ions in and out of the mitochondrial matrix remain unknown. Here, we investigate whether SLP-2, an inner membrane mitochondrial protein of unknown function, modulates the activity of mitochondrial Ca2+transporters. In HeLa cells depleted of SLP-2, the amplitude and duration of mitochondrial Ca2+elevations evoked by agonists were decreased compared to control cells. SLP-2 depletion increased the rates of calcium extrusion from mitochondria. This effect disappeared upon Na+removal or addition of CGP-37157, an inhibitor of the mitochondrial Na+/Ca2+
exchanger, and persisted in permeabilized cells exposed to a fixed cytosolic Na+and Ca2+concentration.
The rates of mitochondrial Ca2+extrusion were prolonged in SLP-2 over-expressing cells, independently of the amplitude of mitochondrial Ca2+elevations. The amplitude of cytosolic Ca2+elevations was increased by SLP-2 depletion and decreased by SLP-2 over-expression. These data show that SLP-2 modulates mitochondrial calcium extrusion, thereby altering the ability of mitochondria to buffer Ca2+and to shape cytosolic Ca2+signals.
© 2009 Elsevier Ltd. All rights reserved.
1. Introduction
Mitochondria are eukaryotic organelles that play a major role in cellular calcium homeostasis. Mitochondrial calcium fluxes are involved in the regulation of several physiological processes includ- ing energy metabolism, insulin secretion, synaptic transmission, cardiac contraction and cell death[1–3]. The transport of calcium ions in and out of the mitochondria involves crossing two mem- branes. The mitochondrial outer membrane (MOM) is relatively permeable to ions in general and calcium transport is mediated by the non-selective voltage-dependent anion channel VDAC[4]. Con- versely, calcium fluxes across the mitochondrial inner membrane (MIM) are tightly regulated, since the MIM is highly impermeable to ions, and requires a variety of specific transport systems[5], see [1]for a recent review. Calcium uptake, for example, is primar- ily mediated by the mitochondrial uniporter[6], but has also been shown to occur through the “rapid-mode calcium uptake” (RaM) channel and the ryanodine receptor isoform 1 (mRyR) in excitable cells[7,8]. Mitochondrial calcium efflux mainly happens through
∗ Corresponding author. Tel.: +41 22 379 5399; fax: +41 22 379 5338.
E-mail address:[email protected](N. Demaurex).
1These authors contributed equally to this work.
2Current address: Ludwig Institute for Cancer Research, University of California, San Diego, 9500 Gilman drive, La Jolla, CA 92093-0670, United States.
the sodium/calcium exchanger (mNCE) but has been shown to be also mediated by a calcium/proton antiporter (mHCE) and the per- meability transition pore (PTP)[9]. Although mitochondrial calcium channels have been studied extensively using a range of biochem- ical approaches and by electrophysiology[6,10], their molecular identity remains unknown. The uncoupling proteins UCP2 and UCP3 have been shown to be essential for mitochondrial Ca2+
uptake, suggesting that these molecules might be part of the Ca2+
uniporter of mitochondria[11]. However, this claim is disputed and awaits confirmation[12,13]. So far, no candidate has been proposed for the mNCE.
Stomatin is a plasma membrane protein that is found in a large number of organisms ranging from mammals to bacteria. Studies on patients suffering from over-hydrated hereditary stomatocyto- sis, a rare autosomal dominant hemolytic anemia, have shown that stomatin was absent from red blood cells of these patients. Inci- dentally, these red blood cells have an increased cationic leak and lyse prematurely[14]. These results have suggested that stomatin is involved in the regulation of cation channel activities. These conclu- sions were supported by studies inC. elegansshowing that stomatin homologues interact with degenerin/sodium channels and mod- ulate their activity[15,16]. Furthermore, stomatin was shown to interact with acid-sensing ion channels and to alter their gating in mammalian cells[17]. Stomatins are the founding members of a family of proteins called stomatin-like proteins which include SLP-
0143-4160/$ – see front matter© 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ceca.2009.10.005
12 S. Da Cruz et al. / Cell Calcium47 (2010) 11–18
1, 2 and 3[18,19]. A function has not yet been ascribed to these three proteins but it is known that SLP-2 is expressed in a range of mammalian tissues, notably the plasma membrane of erythro- cytes[20]. Phylogenic analysis revealed that SLP-2 was acquired through the mitochondrial endosymbiosis and belongs to a differ- ent lineage than other stomatin-like proteins[21]. SLP-2 is highly expressed in several types of human tumors[22], and high SLP-2 levels are associated with decreased survival of patients suffering from primary invasive breast cancer[23], suggesting a role for SLP-2 in tumorigenesis.
In a proteomic study from our laboratory, we identified SLP-2 as a component of the MIM[24]. The same protein was also detected in similar studies of human and plant mitochondria[25,26]. We then confirmed that SLP-2 is attached to the MIM[27]. SLP-2 plays an important role in mitochondria. SLP-2 interacts with MFN2, a com- ponent of the mitochondrial fusion machinery[28], and is required for the stress-induced hyperfusion of mitochondria[29]. SLP-2 reg- ulates the stability of the mitochondrial chaperones prohibitins 1 and 2, of the respiratory chain complexes I and IV[27], and of the long isoform of Opa1[29]. Since SLP-2 appears to play an important scaffolding role in the MIM and is related to stomatin, a molecule known to regulate ion channels, we investigated whether SLP-2 can modulate the activity of mitochondrial ion channels. In this study, we show that SLP-2 is involved in the regulation of mitochondrial calcium homeostasis. Mitochondrial Ca2+release was delayed in SLP-2 over-expressing cells and accelerated in cells depleted of the protein, both in intact cells stimulated with histamine or in per- meabilized cells exposed to known amounts of Ca2+. Altogether we show that SLP-2 may modulate mitochondrial calcium efflux by negatively regulating the mNCE.
2. Materials and methods 2.1. Cell culture and reagents
HeLa cells were cultured in DMEM + 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 2 mM glutamine and maintained in 5% CO2 at 37◦C. Tissue culture plates were obtained from Nunc (Roskilde) and all other cell culture reagents were obtained from Sigma (Buchs). Histamine was from Sigma and CGP-37157 from Tocris.
2.2. RNA interference
shRNA against SLP-2 was directly synthesized in cells using the recently developed pRETRO vector (generously provided by Dr. Agami and previously described in [30]. Nucleotides 697–715 of SLP-2 were chosen as targets for RNA interference.
To generate pRETRO shSLP-2 RNA, the pRETRO vector was digested with BglII and HindIII and the annealed oligos (5GATCC- CCGGCTGAACAGATAAATCAGTTCAAGAGACTGATTTATCTGTTCAG- CCTTTTTGGAAA3) and (5AGCTTTTCCAAAAAGGCTGAACAGATA- AATCAGTCTCTTGAACTGATTTATCTGTTCAGCCGGG3) were ligated into the vectors. Similarly, as a control we generated a pRETRO Luc shRNA, which targets the Luciferase transcripts. HeLa cells were plated on 10 cm dishes and transfected with the appropriate pRETRO constructs using Ca/phosphate method. 24 h after trans- fection, puromycin (Calbiochem) was added at 3g/ml and the cells were incubated for a further 24 h. After puromycin incubation the cells were washed and left to recover for a further 72 h before being collected and processed for Western blotting.
2.3. Cell lysis
Whole cells were lysed for 20 min on ice in lysis buffer (10 mM Hepes, 300 mM KCl, 5 mM MgCl2, 1 mM EGTA, 1% Nonidet P-40,
0.1% SDS, pH 7.4) supplemented with protease inhibitors (Roche).
The lysate was centrifuged at 10,000×gfor 10 min and the protein content of the supernatant determined using a modified Brad- ford assay (Bio-Rad). 15g of total protein was loaded per lane of SDS/PAGE.
2.4. Electrophoresis and Western blotting
Standard SDS-PAGE was performed according to Laemmli. Fol- lowing electrophoresis, proteins were blotted to nitrocellulose membranes. Immunoreactive material was visualized by chelumi- nescence (ECL, Pierce) according to manufacturer’s instructions.
2.5. Antibodies
Anti-SLP-2 antibody was produced by immunizing rabbits with synthetic peptide with a sequence CRKRATVLESEGTRES. The mon- oclonal the anti-GAPDH was from Abcam and the anti-Tubulin from Chemikon International.
2.6. Mitochondrial Ca2+measurements
HeLa cells were plated on 25 mm diameter glass cover-slips and co-transfected with a construct expressing a ratiometric pericam probe targeted to mitochondria (RP3.1mit, gift from Dr. Atsushi Miyawaki) and pRETRO constructs at a 2:1 ratio using Ca/phosphate method. 24 h after transfection, puromycin (Calbiochem) was added at 3g/ml and the cells were incubated for a further 24 h.
After puromycin incubation the cells were washed and left to recover for a further 72 h before Ca2+assays. For over-expressed proteins, HeLa cells were co-transfected with the appropriate construct (pCI or pCI-SLP2-HA) and a construct expressing the mitochondrial-targeted Ca2+probe 4mtD3cpV at a 2:1 ratio using TransFast transfection reagent (Promega). Ca2+assays were per- formed 48 h after transfection. Cover-slips were mounted in a thermostatic chamber (Harvard Apparatus) and experiment per- formed in Hepes-buffered solution containing 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 20 mM Hepes, 10 mM Glucose, pH 7.4 with NaOH.
Cells were imaged on an Axiovert s100 TV using a 100×, 1.3 NA oil-immersion objective (Zeiss). Fluorescence emission was imaged using a cooled, 16-bit CCD back-illuminated frame trans- fer MicroMax camera (Princeton Instruments). Image acquisition and analysis were performed with the Metafluor 6.2 software (Uni- versal Imaging). For RP3.1mit tranfections, cells were excited at 410 and 480 nm, and emission was collected at 535 nm (535DF45, Omega Optical) through a 505DCXR (Omega Optical) dichroic mir- ror. Changes in mitochondrial Ca2+are shown as (1−F/F0) because RP3.1mitfluorescence at410 nm= 410 nm decreases with increas- ing Ca2+concentrations. For 4mtD3cpV transfections, cells were excited at 430 nm with a monochromator (DeltaRam, PTI, Mon- mouth Junction, NJ) through a 455-nm dichroic mirror and imaged sequentially at 475 and 535 nm using a filter wheel (455DRLP, 475DF15, and 535DF25, Omega Optical, Brattleboro, VT).
The maximal calcium efflux rates were calculated by perform- ing a first order derivative on the data obtained during the first minute of the decay phase of the calcium response. Calculation was performed with Microsoft Excel after smoothing of the orig- inal recordings, and the maximal value taken for each individual recording.
2.7. Cytosolic Ca2+measurements
HeLa cells were transfected with the pRETRO constructs using Ca/Phosphate method. 24 h after transfection, puromycin (Cal- biochem) was added at 3g/ml and the cells were incubated for
a further 24 h. After puromycin incubation the cells were washed and left to recover for a further 72 h before being analyzed for Ca2+
assays. For over-expressed SLP-2, HeLa cells were transfected as described above with the appropriate construct (pCI, pCI-SLP-2) and 48 h after transfection, the cells were analyzed for Ca2+assays.
Glass cover-slips were mounted in a thermostatic chamber (Harvard Apparatus) and the cells were imaged as described above. HeLa cells were loaded for 30 min with 2M Fura-2/AM at room temperature in the dark, washed twice and equilibrated for 15 min to allow de-esterification. The experiment was performed in Hepes-buffered solution containing 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 20 mM Hepes, 10 mM glucose, pH 7.4 with NaOH. To monitor the [Ca2+]c, cells were alternatively excited at 340 and 380 nm with a monochromator (DelatRam; Photon Tech- nology International) through a 430 DCLP dichroic mirror. Emission was monitored through a 510WB40 filter (Omega Optical).
2.8. Permeabilized cells
Cells were washed with high K+intracellular buffer (IB), con- taining 130 mM KCl, 10 mM NaCl, 1 mM MgCl2, 5 mM K2HPO4, 1 mM MgATP, 5 mM glucose, 5 mM succinate, 20 mM Hepes (pH 7.2 at 37◦C), supplemented with 0.2 mM EGTA and 0.075 mM CaCl2. For permeabilisation, 5M digitonin was added for 5 min and the cells then kept for 3 min in IB buffer before the addition of CaCl2. Free [Ca2+] was calculated with the Maxchelator program (http://maxchelator.stanford.edu/).
2.9. Mitochondrial membrane potential (m) measurements
Cells were loaded with TMRM (Molecular Probes, 20 nM, 45 min, 37◦C, dissolved in Hank’s Balanced Salt Solution) in the presence of verapamil (20M) to avoid TMRM extrusion by the
MDR. Cells were excited at 545 nm and fluorescence collected through an LP 590 long pass filter. Changes inmwere expressed as the ratio of the fluorescence in mitochondria divided by the cytosolic fluorescence (Fmito/Fcyto), measured in the same cells. At the end of the recording the protonophore carbonylcyanide- p-trifluoromethoxy phenylhydrazone (FCCP) was used to dissipatem.
2.10. Statistics
The significance of differences between means was established using the Student’st-test for unpaired samples (*p< 0.05;**p< 0.01;
***p< 0.001).
3. Results
To investigate whether changes in SLP-2 expression levels could alter mitochondrial Ca2+fluxes, we used RNA interference to down- regulate the expression of SLP-2 (see Section 2). As shown in Fig. 1A, the shRNA targeting SLP-2 efficiently reduced SLP-2 pro- tein levels at 120 h post-transfection, whereas levels of tubulin and GAPDH remained constant. The effects of the down-regulation of SLP-2 expression on mitochondrial Ca2+dynamics were then assessed using a genetically encoded Ca2+-sensitive probe targeted to mitochondria, the “pericam” probe RP3.1mit. The fluorescence of RP3.1mitdecreases with increasing concentrations of Ca2+when excited at 410 nm, enabling to obtain a semi-quantitative measure of the free Ca2+concentration within the mitochondrial matrix, [Ca2+]mit. HeLa cells were co-transfected with RP3.1mitand either the SLP-2 or control shRNA construct and cultured for 120 h before [Ca2+]mitrecordings. As shown inFig. 1B, the amplitude and dura- tion of the [Ca2+]mitelevations evoked by histamine in HeLa cells
Fig. 1.Mitochondrial Ca2+responses in cells depleted of SLP-2. (A) HeLa cells were transfected with the Ctrl shRNA (pRETRO Luc shRNA) or the SLP-2 shRNA (pRETRO SLP-2 shRNA) constructs. 120 h post-transfection, 15g of proteins from the cell extract were analyzed by Western blotting. The levels of endogenous SLP-2 were assessed using the anti-SLP-2 antibody. Tubulin and GAPDH were used as loading controls. (B and C) HeLa cells were transiently co-transfected with the mitochondrial calcium probe RP3.1mitand the indicated shRNA constructs for 120 h. (B) Original recordings of HeLa cells stimulated with 100M histamine in Ca2+-containing medium. (C) Quantification of the effects of the SLP-2 shRNA on the amplitude of the [Ca2+]mitsignal evoked by histamine (top), the integrated [Ca2+]mitresponse (middle, area under the curve) and the maximal mitochondrial Ca2+efflux rate (bottom, derived from the decaying phase of the [Ca2+]mitsignal). Bars are mean±S.E.M. of 38 and 55 cells for Ctrl and SLP-2 shRNA, respectively.
14 S. Da Cruz et al. / Cell Calcium47 (2010) 11–18
Fig. 2.Effect of CGP-37157 on the [Ca2+]mitresponses of SLP-2 knockdown cells. HeLa cells were transiently co-transfected with RP3.1mitand either control or SLP-2 shRNA for 120 h. Cells were pre-incubated for 2 min with 10M CGP-37157 (+CGP) or Hepes-buffered solution before stimulation with histamine. (A and B) Original recordings of HeLa cells stimulated with 100M histamine. Traces obtained in the absence of CGP-37157 are shown for comparison. (C) Statistical evaluation of SLP-2 shRNA effects on the [Ca2+]mitsignal amplitude (top) and maximal mitochondrial Ca2+efflux rates (bottom) measured with or without CGP-37157 (data fromFig. 1). Bars are mean±S.E.M. of 38 vs. 55 and 21 vs. 15 Ctrl and SLP-2 shRNA cells untreated and treated with CGP-37157, respectively.
depleted of SLP-2 were markedly reduced compared to cells trans- fected with the control shRNA (Peak amplitude: 0.16±0.01 in SLP-2 shRNA cells vs. 0.22±0.01 in control cells). As a result, the total amount of Ca2+that transited through the mitochondria, assessed by integrating the Ca2+responses during the 90 s after histamine stimulation, was decreased by 41% in HeLa cells transfected with the SLP-2 shRNA (Fig. 1C; AUC: 7.51±0.57 in SLP-2 shRNA cells vs. 12.81±1.01 in control cells). Detailed analysis of the kinetics of the [Ca2+]mitsignal revealed that the maximal rate of Ca2+extru- sion from mitochondria, measured during the decaying phase of the [Ca2+]mitsignal, was increased in SLP-2 depleted cells compared to control transfectants (Fig. 1C;F/dt= 0.111±0.005 in SLP-2 shRNA cells vs. 0.089±0.007 in control cells). Thus, mitochondria from SLP-2 depleted cells released Ca2+faster than mitochondria from control cells. This behaviour was not due to a reduction of the cytosolic Ca2+elevations (see below). These results indicate that down-regulating the expression of SLP-2 reduced the amplitude and duration of [Ca2+]mitresponses, possibly by increasing the rate of Ca2+extrusion from mitochondria.
The negative membrane potential of respiring mitochondria drives the entry of Ca2+ions into mitochondria. To test whether the reduced [Ca2+]mitsignal could be due to a reduced MIM poten- tial (m) in cells depleted of SLP-2, we measured the m
in cells transfected with control and SLP-2 shRNA. As shown in supplemental Fig. S1, no difference could be observed in them
of control and SLP-2 shRNA cells, either at rest or during the addition of histamine to mobilize Ca2+, or after addition of the protonophore FCCP to dissipatem. These results were con- firmed by flow cytometric analysis of the whole cell population stained with TMRE (data not shown). These data show that deplet- ing cells of SLP-2 did not affect them, thus suggesting that the alterations in mitochondrial Ca2+transport in those cells could not be attributed to differences inm.
To study whether depletion of SLP-2 altered mitochondrial Ca2+
entry or extrusion, we used the specific inhibitor of the mNCE, CGP- 37157[31,32]. As shown inFig. 2, treatment of cells with 10M CGP-37157 transformed the transient [Ca2+]mit elevation evoked by histamine into a sustained [Ca2+]mitelevation, indicating that Ca2+was effectively trapped into the mitochondrial matrix. In these conditions the rate of Ca2+extrusion from mitochondria, measured as inFig. 1, was identical between SLP-2 depleted cells and control cells (Fig. 2C, bottom panel). This suggests that the increased Ca2+
efflux rate of SLP-2 depleted cells was due to an increased activity of the mNCE. However, despite near complete abrogation of mito- chondrial Ca2+extrusion, CGP-37157 did not restore the amplitude of the [Ca2+]mitelevation evoked by histamine in SLP-2 depleted cells to levels observed in control cells (0.17±0.02 vs. 0.24±0.01;
Fig. 2C, top panel). This indicates that increased Ca2+extrusion from mitochondria was not responsible for the blunted amplitude of the [Ca2+]mitelevation induced by histamine.
Two transporters catalyze the extrusion of Ca2+ from mito- chondria, a Na+/Ca2+ exchanger inhibited by CGP-37157 and a H+/Ca2+antiporter reportedly insensitive to CGP-37157. To confirm that the increased mitochondrial Ca2+extrusion of SLP-2 depleted cells was due to increased activity of the Na+/Ca2+exchanger, we measured [Ca2+]mitelevations in the absence of Na+. To avoid con- founding effects due to reversal of the plasma membrane Na+/Ca2+
exchanger, which in the absence of external Na+can catalyze the entry of Ca2+ions into cells, all the experiments were performed in Ca2+-free medium. As shown inFig. 3, Na+ removal mimicked the effects of CGP-37157. The duration of the [Ca2+]mitsignal was greatly prolonged, and the Ca2+efflux rates greatly reduced, but the amplitude of the [Ca2+]mitelevation remained blunted in SLP-2 depleted cells. Importantly, the differences in mitochondrial Ca2+
efflux rates, which persisted in Na+-rich, Ca2+-free solutions, disap- peared entirely in Na+-free, Ca2+-free solutions. These data confirm
Fig. 3.Effect of Na+removal on the [Ca2+]mitresponses of SLP-2 knockdown cells.
HeLa cells were transiently co-transfected with RP3.1mitand either control or SLP-2 shRNA for 120 h. (A) Original recordings of HeLa cells stimulated with 100M his- tamine in Na+-free medium. (B and C) Statistical evaluation of SLP-2 shRNA effects on the [Ca2+]mitsignal amplitude and maximal mitochondrial Ca2+efflux rates, mea- sured in Na+-free and Na+-rich conditions. Bars are mean±S.E.M. of 23 and 21 cells in Na+-free and of 14 and 17 cells in Na+-rich conditions for Ctrl and SLP-2 shRNA, respectively.
that the mNCE is the main mechanism responsible for the increased mitochondrial Ca2+ extrusion observed in SLP-2 depleted cells.
Moreover, they indicate that the defect in mitochondrial Ca2+han- dling associated with SLP-2 expression is independent of the source of Ca2+ions that fuel mitochondria. In Ca2+-free solutions, only the Ca2+that is released from intracellular Ca2+stores contributes to the measured [Ca2+]mitsignal.
Although SLP-2 was identified in a proteome screen from mitochondria, the protein might be expressed in other cellular membranes and thus alter mitochondrial Ca2+extrusion indirectly.
For instance, SLP-2 depletion might increase the cytosolic Na+con- centration, thereby favoring mitochondrial Ca2+extrusion through the Na+/Ca2+ exchanger by increasing the driving force for Na+ entry. To test this possibility, we measured [Ca2+]mit elevations in cells permeabilized with digitonin and maintained at a fixed cytosolic Na+concentration of 10 mM. As shown inFig. 4, robust [Ca2+]mitelevations were evoked by the addition of 5M Ca2+to permeabilized cells. Remarkably, all the alterations observed in intact cells depleted of SLP-2 persisted in permeabilized cells. The amplitude of the [Ca2+]mitresponse was decreased and the kinet- ics of [Ca2+]mitrecovery increased in permeabilized cells depleted of SLP-2. These data establish that SLP-2 alters mitochondrial Na+/Ca2+exchange at the level of mitochondria and not via alter- ations in cytosolic sodium or calcium handling.
To further examine the role of SLP-2 in the regulation of mitochondrial Ca2+ homeostasis, we investigated the effects of SLP-2 over-expression on [Ca2+]mit responses. HeLa cells were co-transfected either with SLP-2 or the empty expression vector together with the ratiometric “cameleon” probe 4mtD3cpv, and [Ca2+]mitmeasured 48 h after transfection. As shown inFig. 5, the maximal amplitude of the [Ca2+]mitsignal was slightly but not sig- nificantly higher in SLP-2 expressing cells compared to control cells.
However, the duration of the [Ca2+]mit signal in those cells was
Fig. 4. Mitochondrial Ca2+responses in permeabilized cells depleted of SLP-2.
HeLa cells were transiently co-transfected with the mitochondrial calcium probe 4mtD3cpv and the indicated shRNA constructs for 120 h. After permeabilization with digitonin, [Ca2+]mitwas measured in intracellular buffer (IB) containing 10 mM Na+. (A) Original [Ca2+]mitrecordings of permeabilized HeLa cells during the addi- tion of 5M free Ca2+. (B) Statistical evaluation of SLP-2 shRNA effects on the [Ca2+]mitresponse amplitude (left), the integrated [Ca2+]mitresponse (middle, area under the curve) and the maximal mitochondrial Ca2+efflux rates (right). Bars are mean±S.E.M of 50 and 34 cells for Ctrl and SLP-2 shRNA, respectively.
Fig. 5. Mitochondrial Ca2+responses in cells over-expressing SLP-2. HeLa cells were transiently co-transfected with a mitochondrial calcium probe and either pCI (=Ctrl) or SLP-2 constructs. (A) Original recordings of HeLa cells stimulated with 30M histamine, recorded with the ratiometric mitochondrial calcium probe 4mtD3cpv.
(B) Statistical evaluation of SLP-2 cDNA effects on the [Ca2+]mitsignal amplitude (left) integrated [Ca2+]mitresponse (middle) and maximal mitochondrial Ca2+efflux rates (right). Bars are mean±S.E.M. of 56 and 43 cells for control and SLP-2 cDNA, respectively.
16 S. Da Cruz et al. / Cell Calcium47 (2010) 11–18
prolonged compared to control cells, and the integrated mitochon- drial Ca2+responses measured during the histamine stimulation was increased by 51% (Fig. 5B, middle panel). This altered kinetics reflected a reduction in the maximal rate of Ca2+extrusion from mitochondria, from 0.028±0.012 in SLP-2 over-expressing cells to 0.062±0.031 in control cells (Fig. 5B, right panel). Thus, mitochon- dria from cells over-expressing SLP-2 released Ca2+more slowly than mitochondria from control cells, an effect opposite to the one measured in SLP-2 depleted cells.
Interestingly, SLP-2 over-expression did not increase the ampli- tude of the [Ca2+]mit response, whereas SLP-2 depletion altered both the amplitude and the kinetics of [Ca2+]mit responses. The decreased amplitude of the [Ca2+]mitsignal in cells depleted of SLP- 2 renders a direct comparison of Ca2+efflux rates difficult, because efflux rates depend on the mitochondrial Ca2+gradient. To enable a quantitative comparison of the data obtained in cells enriched or depleted of SLP-2, we analyzed the recovery rates as a function
Fig. 6.Mitochondrial Ca2+efflux rates as a function of the [Ca2+]mitsignal amplitude.
Maximal efflux rates and [Ca2+]mitsignal amplitude were determined at the same time point. The data were then aggregated for different ranges of [Ca2+]mitvalues to express the efflux rates as a function of [Ca2+]mit. (A) Rate vs. [Ca2+]mitamplitude rela- tionship measured in intact cells over-expressing SLP-2 (circles) or depleted of SLP-2 (triangles). Data are derived from the experiments shown inFigs. 1 and 5, dotted lines are linear regression through the data. (B) Rate vs. [Ca2+]mitamplitude rela- tionship measured in permeabilized cells. Data are derived from the experiments shown inFig. 4.
of [Ca2+]mit. As shown inFig. 6, the SLP-2 effects did not depend on the amplitude of the [Ca2+]mitsignal. In intact cells, SLP-2 over- expression reduced Ca2+efflux rates at all but the smallest [Ca2+]mit concentrations, and SLP-2 depletion increased Ca2+ efflux rates within this range of [Ca2+]mitvalues (Fig. 6A). Similar results were obtained in permeabilized cells depleted of SLP-2, using a different genetically endoded indicator to measure [Ca2+]mit(Fig. 6B). These data indicate that SLP-2 levels alter mitochondrial Ca2+efflux rates independently of the mitochondrial Ca2+ load. The SLP-2 effects thus primarily reflect altered mitochondrial Ca2+extrusion.
To assess whether the alterations in mitochondrial Ca2+han- dling caused by SLP-2 impacted on cell Ca2+ signaling, we also measured cytosolic Ca2+responses ([Ca2+]cyt). As shown inFig. S2, a larger [Ca2+]cyt response was observed in SLP-2 depleted cells compared to control cells, whereas a smaller [Ca2+]cyt response was observed in SLP-2 over-expressing cells. As observed with [Ca2+]mitelevations, both the peak amplitude as well as the dura- tion of the cytosolic Ca2+elevations were altered by the changes in SLP-2 expression levels. Interestingly, the cytosolic and mito- chondrial Ca2+elevations were modulated by SLP-2 in an opposite manner. The larger [Ca2+]cytelevations of SLP-2 depleted cells were associated with smaller [Ca2+]mitelevations, whereas the smaller [Ca2+]cytelevations of SLP-2 expressing cells were associated with larger [Ca2+]mitelevations. The opposite alterations observed in the cytosol and in mitochondria are consistent with an altered Ca2+
sequestration by mitochondria, but not with altered cytosolic Ca2+
handling, which should cause parallel changes in the cytosol and mitochondria. This further confirms that SLP-2 specifically alters mitochondrial Ca2+fluxes.
4. Discussion
SLP-2, a newly discovered MIM protein, is highly homologous to stomatin, a protein known to regulate plasma membrane ion channels. This prompted us to investigate whether SLP-2 could fulfill a similar role for mitochondrial Ca2+channels. For this pur- pose, expression levels of SLP-2 were modulated in HeLa cells, by over-expression or RNA interference, and mitochondrial Ca2+
fluxes were studied using fluorescent mitochondrial-targeted Ca2+
probes. Here, we report that SLP-2 modulates mitochondrial Ca2+
homeostasis, possibly by inhibiting the mNCE activity. In SLP- 2 depleted cells, we observed a reduction in the amplitude and duration of the [Ca2+]mitelevations. Therefore the capacity of mito- chondria to store Ca2+upon histamine stimulation was decreased in those cells. An opposite effect was observed in SLP-2 expressing cells. Here, we observed an increase in the duration of the [Ca2+]mit elevations and thus in the capacity of mitochondria to store Ca2+. In both cases, the converse alterations were observed in the cytosol.
The [Ca2+]cytelevations were increased in SLP-2 depleted cells and decreased in SLP-2 expressing cells. Because a primary cytosolic Ca2+ defect is mirrored in mitochondria, this suggests that the mitochondrial defect is a cause, and not a consequence, of the cytosolic Ca2+defect. Accordingly, decreased mitochondrial Ca2+
storage capacity was observed in permeabilized cells exposed to known Ca2+and Na+concentrations. This indicates that SLP-2 acts at the level of mitochondria to alter the capacity of these organelles to store Ca2+.
One possible explanation for the altered capacity of mitochon- dria to store Ca2+could be that changes in SLP-2 levels alter the Ca2+buffering capacity of mitochondria. In the matrix, Ca2+is most likely to be bound to enzymes, membrane phospholipids and/or phosphate, thus forming insoluble hydroxyapatite[33,34]. There- fore it is possible that, for an unknown reason, depleting cells of SLP-2 alters one of these parameters. This would lead to a decrease in the level of Ca2+that can be retained within the organelle, thereby explaining the increase in Ca2+ efflux kinetics observed in cells
transfected with the SLP-2 shRNA. Although we cannot exclude this possibility, our experimental evidences favor another explanation which implies an alteration of the activity of the mNCE. Following histamine stimulation the mitochondria recover basal levels of cal- cium in about 3 min and this is due to the efflux of calcium through the mNCE[9]. The molecular identity of this exchanger is so far unknown and there is little information about the proteins modu- lating its activity. A study by Yang et al.[35]suggested that protein kinase C (PKC) might act as a regulator of mNCE since its activa- tion enhances mitochondrial Ca2+release. In addition, a chemical compound of the diltiazem family (CGP-37157) has been shown to inhibit the release of Ca2+from mitochondria, probably by acting directly on the mNCE. In our study, CGP-37157 was found to inhibit Ca2+release from mitochondria from SLP-2 depleted cells. A similar inhibition was observed in solutions devoid of sodium, confirming that the increased Ca2+extrusion of SLP-2 depleted cells was medi- ated by the mNCE. Our data suggest that in SLP-2 depleted cells the activity of the mNCE is higher than in control cells.
We recently reported that SLP-2 is required for the stability of the pro-fusion protein Opa1 during stress-induced mitochondrial hyperfusion[29]. Depletion of SLP-2 accelerated the proteolytic cleavage of Opa1 and prevented the fusion of mitochondria induced by inhibitors of protein synthesis. SLP-2 depletion did not frag- ment mitochondria in non-stressed cells, but caused mitochondria to fragment during UV irradiation or exposure to actinomycin.
Here, we observed that mitochondria were partially fragmented in∼20% of our HeLa cells depleted of SLP-2 (data now shown).
In contrast, SLP-2 over-expression never altered the morphol- ogy of mitochondria. This suggests that SLP-2 depleted cells are more prone to mitochondrial fragmentation. Mitochondrial frag- mentation impairs Ca2+propagation within mitochondria[36]and decreases mitochondrial Ca2+uptake by relocating mitochondria away from ER Ca2+release sites[37]. The tendency of mitochon- dria to fragment at low SLP-2 levels might thus contribute to the reduced mitochondrial Ca2+ uptake of SLP-2 depleted cells. The effects of SLP-2 on mitochondrial Ca2+ extrusion, on the other hand, appear independent from the fragmentation state of mito- chondria. Mitochondrial fragmentation is not known to alter the activity of the mNCE, and most cells depleted of SLP-2 had normal mitochondria yet increased mitochondrial Ca2+ extrusion. Con- versely, all cells over-expressing SLP-2 had normal mitochondria but decreased mitochondrial Ca2+extrusion. Thus, the SLP-2 effects on mNCE are likely independent of mitochondrial fission.
One major question raised by our results concerns the mech- anism by which SLP-2 may modulate the activity of the mNCE.
SLP-2 is a MIM protein which interacts with prohibitin and may play a role in regulating the stability of mitochondrial proteins, pos- sibly like a chaperone. SLP-2 also prevents the proteolytic cleavage of Opa1. Therefore we can hypothesize that SLP-2 could regulate mitochondrial ion channels by controlling their stability. Various chaperones have been shown to interact and regulate the activ- ity of ion channels of the plasma membrane[38,39]. Furthermore, chaperones have been shown to inhibit the activity of ion channels through a direct interaction or by interacting with intermediate partners[40,41]. In addition, stomatin, a homologue of SLP-2, is known to interact and negatively regulate mechanoreceptors, the ASIC3 channels in mammalian cells[17]and MEC4 inC. elegans [15,16]. In the nematode, this interaction is mediated by a well- characterized domain which is conserved in SLP-2[16]. SLP-2 has also been shown to contribute to the assembly and maintenance of multimolecular signaling complexes within lipid rafts[42,43].
Destabilization of signalsomes together with loss of Opa1 might alter the activity of the mNCE. Biochemical and genetic evidence indicate that SLP-2 stabilizes the long form of the pro-fusion pro- tein Opa1[29]. Opa1 is not only required for fusion, but also for the formation of the cristae junction[44]. Loss of cristae junctions
might redistribute signaling molecules within the inner membrane of mitochondria and alter the activity of the mNCE. Altogether, this suggests that SLP-2 might act as a chaperone for mNCE. Stomatins have been immunoprecipitated with mechanoreceptors, suggest- ing a rather strong interaction between these two types of proteins.
Based on these data, we think that SLP-2 may represent an inter- esting tool to identify the mNCE by immunoprecipitation assays.
Acknowledgments
We are grateful to Cyril Castelbou for his help for the measure- ments of cytosolic calcium fluxes, and for Sergei Startchik for help in the image analysis. This work was funded by grants from the Swiss National Science Foundation No. 3100A0-118393 (to ND) and 3100A0-109419/1 (to JCM).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the online version, atdoi:10.1016/j.ceca.2009.10.005.
References
[1] G. Szabadkai, M.R. Duchen, Mitochondria: the hub of cellular Ca2+signaling, Physiology (Bethesda) 23 (2008) 84–94.
[2] A. Rimessi, C. Giorgi, P. Pinton, R. Rizzuto, The versatility of mitochondrial cal- cium signals: from stimulation of cell metabolism to induction of cell death, Biochim. Biophys. Acta 1777 (2008) 808–816.
[3] N. Demaurex, D. Poburko, M. Frieden, Regulation of plasma membrane calcium fluxes by mitochondria, Biochim. Biophys. Acta 1787 (2009) 1383–1394.
[4] D. Gincel, H. Zaid, V. Shoshan-Barmatz, Calcium binding and translocation by the voltage-dependent anion channel: a possible regulatory mechanism in mitochondrial function, Biochem. J. 358 (2001) 147–155.
[5] T.E. Gunter, L. Buntinas, G. Sparagna, R. Eliseev, K. Gunter, Mitochondrial cal- cium transport: mechanisms and functions, Cell Calcium 28 (2000) 285–296.
[6] Y. Kirichok, G. Krapivinsky, D.E. Clapham, The mitochondrial calcium uniporter is a highly selective ion channel, Nature 427 (2004) 360–364.
[7] L. Buntinas, K.K. Gunter, G.C. Sparagna, T.E. Gunter, The rapid mode of calcium uptake into heart mitochondria (RaM): comparison to RaM in liver mitochon- dria, Biochim. Biophys. Acta 1504 (2001) 248–261.
[8] G. Beutner, V.K. Sharma, D.R. Giovannucci, D.I. Yule, S.S. Sheu, Identification of a ryanodine receptor in rat heart mitochondria, J. Biol. Chem. 276 (2001) 21482–21488.
[9] T.E. Gunter, D.I. Yule, K.K. Gunter, R.A. Eliseev, J.D. Salter, Calcium and mito- chondria, FEBS Lett. 567 (2004) 96–102.
[10] P. Bernardi, Mitochondrial transport of cations: channels, exchangers, and per- meability transition, Physiol. Rev. 79 (1999) 1127–1155.
[11] M. Trenker, R. Malli, I. Fertschai, S. Levak-Frank, W.F. Graier, Uncoupling pro- teins 2 and 3 are fundamental for mitochondrial Ca2+uniport, Nat. Cell Biol. 9 (2007) 445–452.
[12] P.S. Brookes, N. Parker, J.A. Buckingham, A. Vidal-Puig, A.P. Halestrap, T.E.
Gunter, D.G. Nicholls, P. Bernardi, J.J. Lemasters, M.D. Brand, UCPs—unlikely calcium porters, Nat. Cell Biol. 10 (2008) 1235–1237 (author reply 1237–1240).
[13] M. Trenker, I. Fertschai, R. Malli, W.F. Graier, UCP2/3—likely to be fundamental for mitochondrial Ca(2+) uniport, Nat. Cell Biol. 10 (2008) 1237–1240.
[14] J. Delaunay, G. Stewart, A. Iolascon, Hereditary dehydrated and overhydrated stomatocytosis: recent advances, Curr. Opin. Hematol. 6 (1999) 110–114.
[15] M.B. Goodman, G.G. Ernstrom, D.S. Chelur, R. O’Hagan, C.A. Yao, M. Chalfie, MEC-2 regulatesC. elegansDEG/ENaC channels needed for mechanosensation, Nature 415 (2002) 1039–1042.
[16] S. Zhang, J. Arnadottir, C. Keller, G.A. Caldwell, C.A. Yao, M. Chalfie, MEC-2 is recruited to the putative mechanosensory complex inC. eleganstouch receptor neurons through its stomatin-like domain, Curr. Biol. 14 (2004) 1888–1896.
[17] M.P. Price, R.J. Thompson, J.O. Eshcol, J.A. Wemmie, C.J. Benson, Stomatin modulates gating of acid-sensing ion channels, J. Biol. Chem. 279 (2004) 53886–53891.
[18] G. Seidel, R. Prohaska, Molecular cloning of hSLP-1, a novel human brain- specific member of the band 7/MEC-2 family similar toCaenorhabditis elegans UNC-24, Gene 225 (1998) 23–29.
[19] B.J. Goldstein, H.M. Kulaga, R.R. Reed, Cloning and characterization of SLP3: a novel member of the stomatin family expressed by olfactory receptor neurons, J. Assoc. Res. Otolaryngol. 4 (2003) 74–82.
[20] W.Q. Feng, Z.M. Cui, F.Z. Feng, X.J. Qi, F. Ding, W.D. Li, Z.H. Liu, Expression of SLP-2 mRNA in endometrial cancer and its significance, Zhonghua Fu Chan Ke Za Zhi 40 (2005) 553–557.
[21] J.B. Green, J.P. Young, Slipins: ancient origin, duplication and diversification of the stomatin protein family, BMC Evol. Biol. 8 (2008) 44.
[22] L. Zhang, F. Ding, W. Cao, Z. Liu, W. Liu, Z. Yu, Y. Wu, W. Li, Y. Li, Stomatin-like protein 2 is overexpressed in cancer and involved in regulating cell growth and
18 S. Da Cruz et al. / Cell Calcium47 (2010) 11–18
cell adhesion in human esophageal squamous cell carcinoma, Clin. Cancer Res.
12 (2006) 1639–1646.
[23] W. Cao, B. Zhang, Y. Liu, H. Li, S. Zhang, L. Fu, Y. Niu, L. Ning, X. Cao, Z. Liu, B. Sun, High-level SLP-2 expression and HER-2/neu protein expression are associated with decreased breast cancer patient survival, Am. J. Clin. Pathol. 128 (2007) 430–436.
[24] S. Da Cruz, I. Xenarios, J. Langridge, F. Vilbois, P.A. Parone, J.C. Martinou, Pro- teomic analysis of the mouse liver mitochondrial inner membrane, J. Biol.
Chem. 278 (2003) 41566–41571.
[25] S.W. Taylor, E. Fahy, B. Zhang, G.M. Glenn, D.E. Warnock, S. Wiley, A.N. Mur- phy, S.P. Gaucher, R.A. Capaldi, B.W. Gibson, S.S. Ghosh, Characterization of the human heart mitochondrial proteome, Nat. Biotechnol. 21 (2003) 281–286.
[26] J.L. Heazlewood, J.S. Tonti-Filippini, A.M. Gout, D.A. Day, J. Whelan, A.H. Millar, Experimental analysis of theArabidopsismitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting pre- diction programs, and indicates plant-specific mitochondrial proteins, Plant Cell 16 (2004) 241–256.
[27] S. Da Cruz, P.A. Parone, P. Gonzalo, W.V. Bienvenut, D. Tondera, A. Jourdain, M.
Quadroni, J.C. Martinou, SLP-2 interacts with prohibitins in the mitochondrial inner membrane and contributes to their stability, Biochim. Biophys. Acta 1783 (2008) 904–911.
[28] P. Hajek, A. Chomyn, G. Attardi, Identification of a novel mitochondrial complex containing mitofusin 2 and stomatin-like protein 2, J. Biol. Chem. 282 (2007) 5670–5681.
[29] D. Tondera, S. Grandemange, A. Jourdain, M. Karbowski, Y. Mattenberger, S.
Herzig, S. Da Cruz, P. Clerc, I. Raschke, C. Merkwirth, S. Ehses, F. Krause, D.C.
Chan, C. Alexander, C. Bauer, R. Youle, T. Langer, J.C. Martinou, SLP-2 is required for stress-induced mitochondrial hyperfusion, EMBO J. 28 (2009) 1589–1600.
[30] T.R. Brummelkamp, R. Bernards, R. Agami, Stable suppression of tumorigenicity by virus-mediated RNA interference, Cancer Cell 2 (2002) 243–247.
[31] D.A. Cox, L. Conforti, N. Sperelakis, M.A. Matlib, Selectivity of inhibition of Na(+)–Ca2+exchange of heart mitochondria by benzothiazepine CGP-37157, J. Cardiovasc. Pharmacol. 21 (1993) 595–599.
[32] S. Arnaudeau, W.L. Kelley, J.V. Walsh Jr., N. Demaurex, Mitochondria recycle Ca(2+) to the endoplasmic reticulum and prevent the depletion of neighboring endoplasmic reticulum regions, J. Biol. Chem. 276 (2001) 29430–29439.
[33] Y. Horikawa, A. Goel, A.P. Somlyo, A.V. Somlyo, Mitochondrial calcium in relaxed and tetanized myocardium, Biophys. J. 74 (1998) 1579–1590.
[34] S.A. Thayer, Y.M. Usachev, W.J. Pottorf, Modulating Ca2+clearance from neu- rons, Front. Biosci. 7 (2002) d1255–d1279.
[35] F. Yang, X.P. He, J. Russell, B. Lu, Ca2+influx-independent synaptic potentiation mediated by mitochondrial Na(+)–Ca2+exchanger and protein kinase C, J. Cell Biol. 163 (2003) 511–523.
[36] M. Frieden, D. James, C. Castelbou, A. Danckaert, J.C. Martinou, N. Demaurex, Ca(2+) homeostasis during mitochondrial fragmentation and perinuclear clus- tering induced by hFis1, J. Biol. Chem. 279 (2004) 22704–22714.
[37] G. Szabadkai, A.M. Simoni, M. Chami, M.R. Wieckowski, R.J. Youle, R. Rizzuto, Drp-1-dependent division of the mitochondrial network blocks intraorganellar Ca2+ waves and protects against Ca2+-mediated apoptosis, Mol. Cell 16 (2004) 59–68.
[38] E. Ficker, A.T. Dennis, L. Wang, A.M. Brown, Role of the cytosolic chaperones Hsp70 and Hsp90 in maturation of the cardiac potassium channel HERG, Circ.
Res. 92 (2003) e87–100.
[39] G.C. Meacham, C. Patterson, W. Zhang, J.M. Younger, D.M. Cyr, The Hsc70 co- chaperone CHIP targets immature CFTR for proteasomal degradation, Nat. Cell Biol. 3 (2001) 100–105.
[40] Y.A. Kuryshev, B.A. Wible, T.I. Gudz, A.N. Ramirez, A.M. Brown, KChAP/Kvbeta1.2 interactions and their effects on cardiac Kv channel expression, Am. J. Physiol. Cell Physiol. 281 (2001) C290–C299.
[41] L.C. Miller, L.A. Swayne, L. Chen, Z.P. Feng, J.L. Wacker, P.J. Muchowski, G.W.
Zamponi, J.E. Braun, Cysteine string protein (CSP) inhibition of N-type cal- cium channels is blocked by mutant huntingtin, J. Biol. Chem. 278 (2003) 53072–53081.
[42] M.G. Kirchhof, L.A. Chau, C.D. Lemke, S. Vardhana, P.J. Darlington, M.E. Marquez, R. Taylor, K. Rizkalla, I. Blanca, M.L. Dustin, J. Madrenas, Modulation of T cell activation by stomatin-like protein 2, J. Immunol. 181 (2008) 1927–1936.
[43] D.T. Browman, M.B. Hoegg, S.M. Robbins, The SPFH domain-containing pro- teins: more than lipid raft markers, Trends Cell Biol. 17 (2007) 394–402.
[44] C. Frezza, S. Cipolat, O. Martins de Brito, M. Micaroni, G.V. Beznoussenko, T. Rudka, D. Bartoli, R.S. Polishuck, N.N. Danial, B. De Strooper, L. Scorrano, OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion, Cell 126 (2006) 177–189.