HAL Id: hal-01314294
https://hal.sorbonne-universite.fr/hal-01314294
Submitted on 11 May 2016
HAL is a multi-disciplinary open access
archive for the deposit and dissemination of
sci-entific research documents, whether they are
pub-lished or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés.
Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0
International License
Expanding the Phenotype Associated with NAA10
Related N-terminal Acetylation Deficiency
Chloé Saunier, Svein Isungset Støve, Bernt Popp, Bénédicte Gérard, Marina
Blenski, Nicholas Ahmew, Charlotte de Bie, Paula Goldenberg, Bertrand
Isidor, Boris Keren, et al.
To cite this version:
Chloé Saunier, Svein Isungset Støve, Bernt Popp, Bénédicte Gérard, Marina Blenski, et al.. Expanding
the Phenotype Associated with NAA10 Related N-terminal Acetylation Deficiency. Human Mutation,
Wiley, 2016, �10.1002/humu.23001�. �hal-01314294�
R
ESEARCH
A
RTICLE
OFFICIAL JOURNAL
www.hgvs.org
Expanding the Phenotype Associated with NAA10-Related
N-Terminal Acetylation Deficiency
Chlo ´e Saunier,1,2†Svein Isungset Støve,3,4†Bernt Popp,5B ´en ´edicte G ´erard,6Marina Blenski,3Nicholas AhMew,7 Charlotte de Bie,8Paula Goldenberg,9Bertrand Isidor,10,11Boris Keren,12,13Bruno Leheup,14Laetitia Lampert,14
Cyril Mignot,15Kamer Tezcan,16Grazia M.S. Mancini,17Caroline Nava,12,13Melissa Wasserstein,18Ange-Line Bruel,19,20 Julien Thevenon,1,19,20Alice Masurel,1,19Yannis Duffourd,19,20Paul Kuentz,19,20Fr ´ed ´eric Huet,2,19,20
Jean-Baptiste Rivi `ere,19,20,21Marjon van Slegtenhorst,17Laurence Faivre,1,19,20Am ´elie Piton,6Andr ´e Reis,5† Thomas Arnesen,3,4∗ †Christel Thauvin-Robinet,1,19,20†and Christiane Zweier5†‡
1Centre de R ´ef ´erence maladies rares « Anomalies du D ´eveloppement et syndrome malformatifs » de l’Est et Centre de G ´en ´etique, H ˆopital
d’Enfants, CHU, Dijon, France;2Service de P ´ediatrie, H ˆopital d’Enfants, CHU Dijon, Dijon, France;3Department of Molecular Biology, University of
Bergen, Bergen, Norway;4Department of Surgery, Haukeland University Hospital, Bergen, Norway;5Institute of Human Genetics,
Friedrich-Alexander-Universit ¨at Erlangen-N ¨urnberg (FAU), Erlangen, Germany;6Laboratoire de G ´en ´etique Mol ´eculaire, CHRU Strasbourg,
Strasbourg, France;7Division of Genetics and Metabolism, Children’s National Medical Center, Washington DC;8Department of Genetics,
UMC Utrecht, Utrecht, The Netherlands;9Medical Genetics, Massachusetts General Hospital, Boston, Massachusetts;10Service de G ´en ´etique
M ´edicale, CHU Nantes, Nantes, France;11INSERM, UMR-S 957, Nantes, France;12AP-HP, H ˆopital de la Piti ´e-Salp ˆetri `ere, D ´epartement de
G ´en ´etique, Paris, France;13UPMC, Inserm, CNRS, UM 75, U 1127, UMR 7225, ICM, Paris F-75013, France;14Service de G ´en ´etique M ´edicale, H ˆopital
Brabois, CHU Nancy, Nancy, France;15APHP, D ´epartement de G ´en ´etique et Centre de R ´ef ´erence D ´eficiences Intellectuelles de Causes Rares,
Groupe Hospitalier Piti ´e Salp ˆetri `ere, Paris, France;16Kaiser Permanente, Department of Genetics, Sacramento, California;17Department of
Clinical Genetics, Erasmus University Medical Center, Rotterdam, The Netherlands;18Departments of Genetics and Genomic Sciences and
Pediatrics, Icahn School of Medicine at Mount Sinai, New York;19FHU-TRANSLAD, Universit ´e de Bourgogne/CHU Dijon, Dijon, France;20Equipe
EA4271 GAD, Universit ´e de Bourgogne, Dijon, France;21Laboratoire de G ´en ´etique Mol ´eculaire, PTB, CHU Dijon, Dijon, France
Communicated by Stephen Robertson
Received 2 February 2016; accepted revised manuscript 8 April 2016.
Published online 20 April 2016 in Wiley Online Library (www.wiley.com/humanmutation). DOI: 10.1002/humu.23001
ABSTRACT: N-terminal acetylation is a common protein modification in eukaryotes associated with numerous cel-lular processes. Inherited mutations in NAA10, encod-ing the catalytic subunit of the major N-terminal acety-lation complex NatA have been associated with diverse, syndromic X-linked recessive disorders, whereas de novo missense mutations have been reported in one male and one female individual with severe intellectual disability but otherwise unspecific phenotypes. Thus, the full ge-netic and clinical spectrum of NAA10 deficiency is yet to be delineated. We identified three different novel and one known missense mutation in NAA10, de novo in 11 females, and due to maternal germ line mosaicism in another girl and her more severely affected and deceased
Additional Supporting Information may be found in the online version of this article.
†These authors contributed or supervised equally.
‡Correspondence to: Christiane Zweier, Institute of Human Genetics,
Schwabachan-lage 10, Erlangen 91054, Germany. E-mail: christiane.zweier@uk-erlangen.de ∗Correspondence to: Thomas Arnesen, Department of Molecular Biology, University of Bergen, Thormoehlensgate 55, Bergen N-5020, Norway. E-mail: Thomas.Arnesen@uib.no.
Contract grant sponsors: Dijon University Hospital; Regional Council of Burgundy; Interdisciplinary Center for Clinical Research (IZKF) Erlangen (projects E16 and E26); German Research Foundation DFG (Zw184/1-2); Norwegian Cancer Society; The Bergen Research Foundation BFS; Research Council of Norway (grant 230865); Western Norway Regional Health Authority.
brother. In vitro enzymatic assays for the novel, recurrent mutations p.(Arg83Cys) and p.(Phe128Leu) revealed re-duced catalytic activity. X-inactivation was random in five females. The core phenotype of X-linked NAA10-related N-terminal-acetyltransferase deficiency in both males and females includes developmental delay, severe intellectual disability, postnatal growth failure with severe micro-cephaly, and skeletal or cardiac anomalies. Genotype– phenotype correlations within and between both genders are complex and may include various factors such as lo-cation and nature of mutations, enzymatic stability and activity, and X-inactivation in females.
Hum Mutat 00:1–10, 2016. Published 2016 Wiley Periodicals, Inc.∗∗
KEY WORDS: NAA10; X-linked; intellectual disability; N-terminal acetylation
Introduction
N-terminal acetylation is a common protein modification in eu-karyotes [Arnesen et al., 2009]. Recently, N-terminal acetylation was shown to act as a degradation signal to regulate protein com-plex stoichiometry, protein comcom-plex formation, subcellular target-ing, and protein folding [Behnia et al., 2004; Setty et al., 2004; Forte et al., 2011; Scott et al., 2011; Shemorry et al., 2013; Holmes et al., 2014]. It is likely that the physiological role of N-terminal acety-lation may vary, depending on the protein substrate. Six human
C
2016 The Authors.∗∗Human Mutation published by Wiley Periodicals, Inc. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
N-acetyltransferase enzymes (NATs) have been identified and des-ignated NatA-NatF [Aksnes et al., 2015]. NatA has a major role and modifies approximately 40% of all human proteins [Arnesen et al., 2009]. It is composed of a catalytic subunit encoded by NAA10 (ARD1; MIM #300013) (http://www.ncbi.nlm.nih.gov/omim) and an auxiliary subunit encoded by NAA15 (NAT1/NATH; MIM #608000) [Mullen et al., 1989; Arnesen et al., 2005].
In recent years, mutations in the X-chromosomal NAA10 gene have been implicated in various disease phenotypes. In 2011, Rope et al. identified the same missense mutation, p.(Ser37Pro) in two independent families with Ogden syndrome (MIM #300855), an X-linked recessive lethal disorder. Five affected males from one family and three affected males from the other family presented with a dis-tinctive phenotype including postnatal growth failure, global severe developmental delay, an aged appearance with reduced subcuta-neous fat, skin laxity, wrinkled foreheads, and facial dysmorphism such as prominent eyes, down-slanting palpebral fissures, thick-ened lids, large ears, flared nares with hypoplastic alae, short col-umella, protruding upper lip and microretrognathia. Furthermore, hypotonia progressing to hypertonia, cryptorchidism, hernias, large fontanels, and structural cardiac anomalies and/or arrhythmias were commonly noted. These individuals died between the ages of 5 and 16 months, mainly due to cardiac arrhythmias [Rope et al., 2011].
In 2014, NAA10 was implicated in a second, distinct X-linked re-cessive disorder with syndromic microphthalmia (MCOPS1; MIM #309800). Esmailpour et al. identified the splice-site mutation
c.471+2T>A in a family with Lenz microphthalmia syndrome.
Several affected males presented with congenital bilateral anoph-thalmia, postnatal growth failure, hypotonia, skeletal anomalies such as scoliosis, pectus excavatum, finger, and toe syndactyly or clinodactyly, and with abnormal ears, fetal pads, and cardiac and renal anomalies. They had delayed motor development and mild to severe intellectual disability (ID) with remarkable intrafamilial variability. Furthermore, behavioral anomalies and seizures were re-ported. Three female carriers showed mild symptoms such as abnor-mally shaped ears and syndactyly of toes [Esmailpour et al., 2014].
Trio whole-exome sequencing within a larger study revealed the de novo missense mutation p.(Arg116Trp) in a boy with severe intellectual disability [Rauch et al., 2012]. Interestingly, shortly after another de novo missense mutation p.(Val107Phe) was identified in a female [Popp et al., 2015]. Both individuals with de novo mutations had severe cognitive impairment and showed variable other anomalies such as postnatal growth retardation, muscular hy-potonia and skeletal, cardiac, and behavioral anomalies [Popp et al., 2015]. However, their phenotype was milder and less recognizable due to fewer malformations compared with the distinct syndromic entities of Ogden and syndromic microphthalmia syndromes [Popp et al., 2015]. Only very recently, another mutation in NAA10, p.(Tyr43Ser), was reported in two brothers with mild to moderate intellectual disability, scoliosis, and long QT and in their mildly affected mother [Casey et al., 2015].
Different levels of remaining enzymatic activity, but also the di-versity of NAA10 function, of which various aspects are poten-tially specifically targeted by different mutations, were discussed as underlying the various NAA10 associated phenotypes [Esmailpour et al., 2014; Aksnes et al., 2015; Casey et al., 2015; Dorfel and Lyon, 2015; Popp et al., 2015]. However, given the small number of af-fected individuals and genetic variants identified as well as the lack of complete and comparative mechanistic investigations, no solid conclusion could yet be drawn.
We now report on a total of 12 affected females with four different de novo missense mutations in NAA10 and one inherited mutation in a familial case due to germline mosaicism, thus further expanding
the mutational and clinical spectrum associated with NAA10 related N-terminal-acetyltransferase deficiency.
Material and Methods
Individuals and Mutation Detection
All novel 11 affected females were seen and diagnosed in different centers worldwide. In all but individuals 4, 6, and 7, the mutation was detected by (trio) exome sequencing. Testing strategy in individ-ual 5 has been recently published elsewhere [Thevenon et al., 2016]. In individuals 4, 6, and 7, the mutations were identified by targeted high-throughput sequencing of 275 genes implicated in intellectual disability (individual 6 and 7) as described elsewhere for a previous version of the sequencing approach [Redin et al., 2014] or by using the TruSight One sequencing panel by Illumina, containing approx-imately 4,800 disease associated genes (individual 4). In addition, we re-evaluated in detail a female with de novo mutation in NAA10 who we recently reported (individual 1) [Popp et al., 2015]. Targeted mutation testing in the affected brother of individual 12 was done by Sanger sequencing. Analyses were performed either in a diag-nostic or research setting, and informed consent was obtained from parents or guardians of all affected. If done in a research setting, the studies were approved by the ethic committees of the respective universities or centers.
Mutations and their de novo occurrence were confirmed by Sanger sequencing in the respective center. Gene version NM 003491.3 was used as reference. Nucleotide numbering uses
+1 as the A of the ATG translation initiation codon in the reference
sequence, with the initiation codon as codon 1. The identified vari-ants in NAA10 were submitted to the LOVD gene variant database at http://www.lovd.nl/NAA10 (individual IDs 60301—60312).
In silico prediction was performed with online programs SIFT [Kumar et al., 2009] (http://sift.jcvi.org/), PolyPhen-2 [Adzhubei et al., 2010] (http://genetics.bwh.harvard.edu/pph2/), and Mutation Taster [Schwarz et al., 2014] (http://www.mutationtaster.org/). X-inactivation
X-Inactivation testing at the androgen receptor locus was per-formed on lymphocytes of seven individuals according to standard procedures [Allen et al., 1992; Lau et al., 1997].
Homology modelling
Structural consequences of the p.(Arg83Cys), the p.(Phe128Leu), and the p.(Phe128Ile) mutations were studied using a previously established homology model of the human NAA10 enzyme based on the structural coordinates of S. pombe Naa10 [Myklebust et al., 2015] and visualized using MODELLER [Eswar et al., 2007]. Plasmid construction and protein purification
Mutant His/MPB-NAA10 and NAA10-V5 plasmids containing the p.(Arg83Cys), the p.(Phe128Leu), or p.(Phe128Ile) mutation
were created by site-directed mutagenesis (QuikChangeR Multi
Site-Directed Mutagenesis Kit, Agilent Technologies, Santa Clara, CA) according to the manufacturer’s protocol and as described pre-viously [Popp et al., 2015] with the primers NAA10 R83C Fwd:
5 GCGTTCCCACCGGCGCCTCGGTCTGGCTCAGAAACTGAT
GG and NAA10 R83C Rev: 5CCATCAGTTTCTGAGCCAGACCG
AGGCGCCGGTGGGAACGC. Protein purification was performed
Figure 1. Mutations identified in NAA10. A: Schematic representation of the NAA10 protein, encoding exons (numbered after NM_003491.3), domains (based on NCBI reference NP_003482.1, UniProt P41227 and the crystal structure of the NatA complex [Liszczak et al., 2013]), and localization of mutations in affected males (blue circles) and females (red circles). #, previously published mutations [Rauch et al., 2012; Rope et al., 2011; Esmailpour et al., 2014; Popp et al., 2015]. One letter codes were used due to space constraint. For the mutation c.471+2T>A described by Esmailpour et al. (2014) and the deduced protein level changes (p.(Leu158Valfs∗46), p.(Glu157_Leu158ins9)), the presumably expressed truncated transcript 1 was used for labelling. B: NAA10 homology model highlighting Arginine 83 and 116. These are localized in the Ac-CoA binding pocket.
C: NAA10 homology model showing the localization of Phe128, with its side chain pointing toward the hydrophobic core, similar to Val107. This
amino acid was mutated in a previously published patient [Popp et al., 2015]. as described previously [Popp et al., 2015]. Buffers used for pro-tein purification were: IMAC wash buffer (50 mM Tris-HCl [pH 7.4], 300 mM NaCl, 1 mM DTT, 25 mM Imidazole), IMAC elution buffer (50 mM Tris-HCl [pH 7.4], 300 mM NaCl, 1 mM DTT, 300 mM Imidazole), and size-exclusion chromatography buffer (50 mM HEPES [pH 7.5], 300 mM NaCl, 1 mM DTT. All enzymes that were purified and used for enzymatic acetylation assays were more than 95% pure.
In vitro acetylation assays
A colorimetric acetylation assay [Thompson et al., 2004] and a quantitative HPLC assay [Evjenth et al., 2009] were used to measure the catalytic activity of the NAA10 variants as described previously [Popp et al., 2015]. Purified enzyme was mixed with Acetyl-CoA (Ac-CoA), substrate peptides, and acetylation buffer (50 mM HEPES pH 7.5, 100 mM NaCl, and 2 mM EDTA), and reactions were carried out at 37˚C. NAT activity was measured in the linear
phase of the reaction. For Kmand kcatdetermination, enzymes were
mixed with 500μM oligopeptide and Ac-CoA ranging from 10
μM to 1 mM. Due to the low catalytic activity of p.(Phe128Leu), kinetic constants were determined only for NAA10 WT and NAA10 p.(Arg83Cys).
Protein stability analysis for the p.(Arg83Cys) and the p.(Phe128Leu) mutations by cycloheximide chase assay
Cycloheximide chase experiments were performed as described previously [Casey et al., 2015]. Briefly, HeLa cells were plated on
six-well plates and transfected with 2.6μg plasmid using X-tremeGENE
nine DNA transfection reagent (Roche, Basel, Switzerland). Forty
eight hours after transfection, 50μg/ml cycloheximide was added
to the cells that subsequently were harvested at 0, 2, 4, and 6 hr post-treatment. V5-tagged NAA10 variants were detected using a standard Western blotting procedure with anti-V5-tag antibody (R960-25; Invitrogen, ThermoFisher Scientific, Waltham, MA),
anti-β-Tubulin antibody (T5293; Sigma–Aldrich, St. Louis, MO),
and anti-NAA15 antibody (anti-NATH). Signals were detected by
using ChemiDocTM XRS+system of Bio-RAD (Hercules, CA),
and normalization and quantification of the signals was done with ImageLabTM system 5 of Bio-RAD. Each mutant was analyzed at least three times in independent experiments.
Results
Mutational Spectrum
Five different missense mutations in NAA10 were identified in 12 female patients and one affected male (Fig. 1A; Supp. Table S1). The p.(Val107Phe) mutation has been reported previously [Popp et al., 2015] and is so far unique. Also, the p.(Arg116Trp) mutation has been reported previously, but in an affected boy [Popp et al., 2015]. Two mutations, p.(Phe128Ile) and p.(Phe128Leu), affect the same, highly conserved amino acid. The mutation p.(Phe128Ile) was identified in one female as recently reported [Thevenon et al., 2016], whereas p.(Phe128Leu) was identified in two unrelated female individuals. The recurrent mutation p.(Arg83Cys) was detected in seven females, one of them having an affected brother
who deceased at the age of 1 week. In this family, maternal germ line mosaicism was assumed because exome data did not reveal the mutation in the mother’s blood sample and because of recurrence in a third pregnancy terminated after prenatal diagnosis. In all other 11 individuals, the mutation was shown to have occurred de novo.
None of the five missense mutations was found in the ExAC browser [Lek et al., 2015] (status November 2015) (http://exac.broadinstitute.org/). All affect highly conserved amino acids (Supp. Fig. S1 and [Popp et al., 2015]) and were classified as damaging or disease causing by Mutation Taster and SIFT and four of them as possibly or probably damaging by PolyPhen-2 (Supp. Ta-ble S2). X-inactivation was random in four tested individuals, mildly skewed (92%) in one and completely skewed (100%) in another.
Clinical Phenotype
Clinical details of the affected individuals are displayed in Table 1. All 12 females are moderately to severely intellectually disabled. Age of walking ranges from 18 months to not being able to walk unassisted at age 8 years 6 months. Age of first words ranges from 15 months to no speech at age 8 years 6 months. Most of the individuals, though many still young, are nonverbal; one is reported to have a good vocabulary but not regularly using full sentences. Behavioral anomalies are described in seven girls and include stereotypic movements, self-hugging, attention deficit, aggressivity, and unmotivated laughter. Possible seizures or EEG anomalies were reported in only two of the individuals.
Birth measurements were in the normal or low normal range for most of the individuals. However, postnatal growth failure of length and/or head circumference occurred in most of the girls for whom this data were available. At age of last investigation (17 months– 9 years), all but individuals 2 and 11 had head circumferences
be-tween–2.8 to–5.3 standard deviations (SD) below the mean. In
relation, growth retardation regarding height was milder, and at age of last investigation length/height was in the normal or low normal
range in seven individuals and between–2.5 and–3.75 SD in five.
Feeding difficulties, either temporarily in infancy or continuously with the need of tube feeding, were reported in nine girls.
Muscular hypotonia was noted in almost all individuals, often more pronounced axially and with hypertonia of the extremities. Brain imaging, either by MRI or CNS ultrasound revealed frequent but rather unspecific anomalies. Structural cardiac anomalies such as pulmonary stenosis and atrium septum defects were observed in two females, cardiac conduction anomalies in five (twice long QT and three times incomplete right bundle branch block). Large fontanels were reported in four girls, and delayed bone age in one, but not tested in the others. Skeletal anomalies such as pectus excavatum or carinatum or vertebral anomalies were reported in five girls.
Various, but rather unspecific facial dysmorphism such as bitem-poral narrowing, mildly up-slanting palpebral fissures, a prominent forehead, uplifted earlobes, hirsutism, or an up-turned nose were common. In several individuals, long eyelashes and arched, promi-nent eyebrows, or synophrys were noted (Fig. 2).
In one of the families, the p.(Arg83Cys) mutation also occurred in an affected brother due to maternal germ line mosaicism. This boy was born at gestational week 36 with normal birth length and weight. He had generalized hypotonia, lack of spontaneous respira-tion, and died at age 1 week. He had persistent pulmonary hyperten-sion, supraventricular tachycardia, and mild ventricular hypertro-phy. Ultrasound examination of the CNS showed ventriculomegaly, and small cortical kidney cysts were noted. Furthermore, he was
reported to have had large fontanels, bilateral hallux valgi, sandal gaps, a broad forehead, and micrognathia. A third, male pregnancy in this family was terminated after identifying the NAA10 mutation prenatally.
Homology Modelling
The missense mutation p.(Arg83Cys) is located in the Ac-CoA binding site of NAA10, and the amino acid Arg83 might thus play an important role in the recruitment of Ac-CoA to the enzyme (Fig. 1B). The amino acids Arg83 and Arg116, the latter also mutated in a male individual (p.Arg116Trp) in an earlier study [Popp et al., 2015], are both positively charged and positioned on the rim of the Ac-CoA binding site. We thus suspect that the p.(Arg83Cys) mutation will have similar (or more adverse) effects as the p.(Arg116Trp) mutation previously identified. Phe128 on the other hand is not located in the active site of the enzyme (Fig. 1C).
This residue is located in the loop region betweenα4 and β6 of
NAA10. The sidechain of Phe128 is pointing in toward a
hydropho-bic pocket betweenβ4, α3, β5, α4, and β7. Previously, we described
the p.(Val107Phe) variant whose sidechain is pointing toward the very same hydrophobic pocket and which resulted in more than 90% reduction of catalytic activity, most likely due to structural alterations or a reduced stability [Popp et al., 2015]. This indicates that the large bulky sidechain of Phe128 is necessary for this hydrophobic pocket and that the introduction of the much smaller Leucine or Isoleucine is causing a destabilization of the enzyme.
In vitro enzymatic assays and in cellula stability measurements
In order to study the catalytic activity of NAA10 variants, plasmids coding for a His/MBP-NAA10 WT fusion protein, a NAA10 p.(Arg83Cys) fusion protein and a His/MBP-NAA10 p.(Phe128Leu) fusion protein were expressed in E. coli BL21 cells and purified. Interestingly, while NAA10 WT and NAA10 p.(Arg83Cys) eluted as monomers from the size-exclusion chro-matography column, the NAA10 p.(Phe128Leu) eluted mainly in the void volume of the column (Supp. Fig. S2). This was also seen for another previously described NAA10 variant (p.(Tyr43Ser)) [Casey et al., 2015], and suggests that the protein has an altered protein structure or a reduced protein stability, causing it to aggregate in units larger than 200 kDa. For further enzymatic testing, only frac-tions of monomeric enzymes were used.
In vitro enzymatic assays revealed a drastic reduction of catalytic activity for NAA10 p.(Phe128Leu) (similarly to previously published NAA10 p.(Val107Phe) [Popp et al., 2015] and p.(Tyr43Ser) [Casey et al., 2015]), whereas the p.(Arg83Cys) mutation resulted in an ap-proximately 60% reduction of catalytic activity (Fig. 3A). Together, these data support our findings from the homology model, suggest-ing that the p.(Phe128Leu) and p.(Phe128Ile) mutations interfere with the overall structure of NAA10 and possibly also destabilize the protein, whereas the p.(Arg83Cys) mutation interferes with Ac-CoA binding.
In order to further study whether the p.(Arg83Cys) mutation af-fects Ac-CoA, we determined steady-state kinetic constants (Supp. Fig. S3). The Km for Ac-CoA is approximately threefold higher for the p.(Arg83Cys) variant compared with wild-type (WT) NAA10, indicating that the p.(Arg83Cys) variant has a reduced affinity to-ward Ac-CoA, and that this is the main cause of the reduced overall catalytic activity for this variant.
Table 1. C linical Details o f P atients w ith De Novo Mutations in NAA10 In d iv id u al 1[ P o p p et al ., 2015] 2 3 4 5[ T h ev en o n et al., 2016] 6 7 8 9 10 11 12 ∗ 13 ∗ NA A 10 mut at ion c.319G >T, p .( V al107Phe) c.346C >T, p .(A rg116T rp ) c.384T >A, p .(Phe128L eu) c.384T >A, p .(Phe128L eu) c.382T >A, p .(Phe128Ile) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) c.247C >T, p .(A rg83C ys) X-inact. Random Random Random N A Random Random 92% N A N A N A 100% N A N A In h er it an ce D e n ovo D e n ovo D e n ovo D e n ovo D e n ovo D en o vo D en o vo D en o vo D en o vo D en o vo D en o vo M G M M G M Mu ta ti o n de te ct ed b y T rio ex ome T ri o ex o me Ex ome T ri o p ane l (T S 1 ) T rio ex ome P ane l P ane l T ri o ex o me Ex ome E xo me T rio ex ome T ri o ex o me T arge te d Gender F emale F emale F emale F emale F emale F emale F emale F emale F emale F emale F emale F emale M ale Ag e la st in ve stigat. 8y 2mo 8 y 1 mo 17mo 8 y 6 mo 6y 5mo 4 y 2 mo 4y 3mo 2 y 2 mo 3y 10mo 10y 6mo 4 y 6 y 6 mo 1wk/ †1wk Bi rt h Gestational we ek Te rm 3 9 +2 4 1 3 4 T er m T er m T er m 3 4 (tw ins) 38 +13 7 +14 0 4 1 3 6 W eig ht (g/SD) N o rm al 3,350/0 3 ,020/ –1.2 1 ,700/ –1.3 2 ,670/ –1.65 3,290/ –0.25 3,095/ –0.67 2,210/0.2 2 ,540/ –1.21 3,175/0.65 2,500/ –2.31 3,470/ –0.25 3,210/1.1 Len gt h (cm/SD) N o rm al 49/ –1 51/ –0.13 N A 47/ –1.51 51/ –0.25 47/ –1.51 44/0 48/ –0.3 52/1.72 49/ –1.23 N A N A OFC (cm/SD) N A N A 32/ –2.07 N A 32/ –1.96 N A 34/ –0.51 30.5/0.1 32.4/ –0.8 9 NA NA NA 3 5 .5 /1 .9 Gro w th G ro w th fail ur e Y es N o N o Y es Y es Y es Y es Y es Y es Y es N o Y es N A He ig h t (cm/SD) 108/ –3.79 140/1.4 83.1/ –0.92 115/ –2.5 105/ –2.65 97/ –1.44 97/ –1.6 79.5/ –2.56 88.3/ –3.15 144/0.06 N or mal 9 0/ –1.62 (3y 2mo) NA We ig h t (kg/SD) 17.5/ –2.9 33.7/0.5 ?/ –0.39 17.2/ –2.5 13.1/ –4.12 15/ –0.8 12.6/ –2.46 9.76/ –2.26 11.2/ –3.16 35/0.54 N o rm al 14/ –0.35 (3y 2mo) NA OFC (cm/SD) 48.5/ –3.01 51/ –0.3 41.7/ –5.3 46/ –4 46.2/ –5.15 47/ –3.5 47/ –3.59 44.7/ –3.86 44.5/ –4.85 (3y 5mo) 48 cm/ –2.8 (6y) 48.5/ –1.27 45/ –4.58 (3y 2mo) NA CNS De ve lo pm. dela y/ID Se ve re M o der at e (IQ 50) S eve re Pro fo u n d Y es S ev er e Y es S eve re S eve re M o d er at e S eve re S eve re N A A ge o f w alking 5y 18mo N ot ye t N ot ye t 18mo N ot ye t (3y 6mo) N o t yet N o t yet 3y 24mo N ot ye t N A First wo rd s/ cu rr en t speec h No t ye t/ si gn s and sounds 15mo N ot ye t/ co n so n an t babbles No t ye t No t ye t 2 y (2 w o rd s) No t ye t No t ye t 3 y / go o d ,b u t not al w ay s full sent enc es No t ye t No t ye t, so u n d s NA Seizur es (age) N o N o
Infantile spasms (4mo)
5 y No No No No "S p el ls " vs . seizur es No No No NA EEG anomalies NA M yo cl o n ic , gener aliz ed Bi fr on ta l slo w -wa ves, spik e-wa ves NA No No No No No Y es Hy p o to n ia / hy p er to n ia Ax ia l hy p o /p er ip h hy p er H ypo Sev er e h ypo A xial hy p o /p er ip h hy p er Ax ia l hy p o /p er ip h hy p er Hy p o Hy p o Hy p o (a xi al > pe ri p h ) Hy p o /h yp er Hy p o No P er ip h h yp er H yp o Br ai n im ag in g anomalies US nor m al MRI n or mal (6y) MRI (9mo): par enc h y-mal at roph y, thin CC N o rm al (1y) Supr av ent ri cular cyst w ithout hy d ro ce p h al y N o H ippocampic dys gen es is MRI (20mo): pe ri ve ntr . whit e m att er loss IVH o cc ipital hor n ,P VL, HIE MRI n or mal (12mo ,3y) Bo rd er line ve n tr ic u -lome ga ly MRI: thin CC Dilat ed lat. ve n tr ic le s, thin CC US (pr e-and pe ri nat al ): ve n tr ic u -lome ga ly (C ont inued )
Table 1. C ontinued Indi vi dual 1[ P o p p et al ., 2015] 2 3 4 5[ T h ev en o n et al., 2016] 6 7 8 9 10 11 12 ∗ 13 ∗ Beha vio ral anomalies Ac ti ve ,s h o rt att ention span, fr iendly ADHD N o St er eot ypies, hand washing , unc er tain ey e co n ta ct Un m o ti va te d laug ht er Ag gr es si vi ty N o Ha p p y disposition Ve ry ac ti ve , happ y, pr oblems in new setting s Hy p er ac ti vi ty , little ey e co n ta ct , agg ressi vi ty R estlessness, att ention deficit, h appy disposition NA Vi sc er al Car d ia c anomalies P AS, ASD ,long QT (m ax QT time 484 ms) In co m p le te ri ch t b undle br anch block M ild left ve nt r. diast olic d ysfunc-tio n ,E CG nor m al No In co m p le te ri gh t bundle br anch blo ck No No M il d P A S ,P F O vs. A SD No L o n g Q T In co m p le te ri gh t b undle br anch block No S V T ,p u lm . hy p er t. , mild ventr ic . hy p er tr o p hy E ye anomalies A stig m atism, st ra bism, m ild op ti cu s atr o ph y No C o rt ic al vi si o n impair ment C o rt ical vi sual impair -ment, ambly o pia H yper o pia, astig m atism, ex ot ro pia No No M yo p ia , astig m atism Alt er n at ing esot ro pia, co rt ic al vi si o n impair ment As ti gm at is m , h yper o pia H yper o pia M egalo papillae, m yo pia NA Ur o ge n it al / kidne y anomalies No NA NA NA No NA No NA No P re n at al re n al fluid No Sm al l cy st s unilat er al Diffuse small co rt ic al kidne y cysts Sk ele tal Large fontanels Ye s N o N o N A N A N o N A Ye s Ye s Ye s N o N o Ye s Dela ye d b one age Y es N A N A N o N AN A N AN AN A N A N A N A N A Ha n d anomalies No No No No No No No No Sm al l h an d s No C li n o d ac ty ly V Sm al l h an d s, tap er ing fingers NA F ee t an o m al ie s B ro ad gr ea t to es N oN oN o N o N oN o N o Sm al l N o N o Sm al l fe et an d to es Ha ll u x va ru s, sandal gap Thor acic anomalies Mi ld p ec tu s car inatum No No No No No No Su p er n u m er ar y ve rt eb ra , dys m or ph ic L1 ve rt ebr a Ye s M il d p ec tu s ex ca va tu m Pe ct u s ex ca va tu m Pe ct u s ex ca va tu m NA
Other Feeding difficulties
Y es, infancy N o Y es, g-tube Y es, tube in infancy , ch o k in g Y es Y es N o Y es, infancy Y es M ild, in infancy Ye s, in fa n cy N A N A Othe r anomalies or difficulties Re cu rr en t infections, hig h pain thr eshold D C D P yr amidal sig n s, dys ton ic post ur es N ar ro w palat e VP sh unt, h ig h palat e Re so lv ed cu ti s mar m or ata Sleeping pr oblems Cu ti s mar m or ata ∗sibling s. MGM, mat er nal ger m line mosaicism; anom., anomalies; T S1, T ru sig ht One sequencing panel (Ill u mina); †, d ec eased; m u t., m utation; mo , m onths; y, ye ars; wk(s), w eek(s); N A , not av ailable/applicable; OFC, oc cipit ofr o ntal head cir cumfer enc e; CNS, ce nt ra l n er vo us syst em; ID , int ellec tual disabilit y; U S, ult rasound; CC, co rp us callosum; US, ult rasound; h yop , h yp ot onia; h yp er , h yp er to ni a; p er iph, p er ipher al; ADHD , att ention deficit h yp er ac ti vit y disor d er ; P AS, p ulmonar y ar te ry st enosis; ASD ,at ri al septum defec t; S VT ,s upr av ent ricular tac h ycar dia; US, ult rasound; D C D ,(de velopmental co or dination disor d er); HIE, h yp o xic-isc hem ic enc ephalopath y; P VL, p er iv ent ricular le u ko malacia; V P, ve nt riculo-p er it oneal.
Figure 2. Facial phenotypes of females with NAA10-related N-terminal-acetyltransferase deficiency. Note only minor dysmorphic aspects and a rather unspecific facial gestalt in most of the girls. Some have prominent or arched eyebrows.
We also assessed the stability of the NAA10 variants by over-expression in HeLa cells followed by cycloheximide-chase experi-ments. The NAA10 p.(Phe128Leu) variant was less stable compared with NAA10 WT (Fig. 3B–E). Similar findings were observed for NAA10 Phe128Ile (data not shown). In contrast, protein stability does not seem to be affected by the p.(Arg83Cys) mutation.
Discussion
Delineation of the Phenotype in Females with
NAA10-Related N-Terminal-Acetyltransferase Deficiency We describe 12 female individuals, 11 of whom carry de novo missense mutations in NAA10, a gene previously implicated in dif-ferent X-linked recessive disorders. The herewith reported females all have moderate to severe ID and variable other anomalies, partly overlapping with those in the affected males but with a generally milder and less characteristic phenotype.
Several common clinical aspects could be noted among the af-fected females. All had moderate to severe developmental delay and ID with no or very limited speech and often with limited mobility. While birth measurements were often in the normal or low normal range, postnatal growth failure commonly occurred, also resulting in severe microcephaly. Skeletal, brain, and organ anomalies were frequent, but without any apparent specific pattern. Minor, but of-ten rather unspecific facial dysmorphism were observed in most of the patients. In several individuals, arched eyebrows or syn-ophrys were noted, which, if present, in combination with short
stature and intellectual disability might bear some resemblance to Cornelia-de-Lange syndrome (CDLS1; MIM #122470, CDLS2; MIM #300590, CDLS3; MIM #610759, CDLS4; MIM #614701, CDLS5; MIM #300882). As the p.(Arg83Cys) mutation was recur-rently identified in seven girls, we wondered whether it might be accompanied by specific phenotypic aspects. However, we could not deduce any obvious differences in clinical appearance be-tween individuals with this mutation or one of the other missense mutations.
Importantly, cardiac conduction anomalies were observed in five of the females. This might be a milder manifestation of the car-diac arrhythmias that were frequent and often lethal in many of the boys with Ogden syndrome [Rope et al., 2011]. Also, very recently, long-QT was observed in two male individuals and their mother with NAA10-related N-terminal acetylation deficiency [Casey et al., 2015]. As the observation of conduction defects has important con-sequences, such anomalies should be specifically tested in newly identified individuals. Furthermore, specific recommendations for surveillance, medication, or avoidance of risk factors should be given to families with affected children. As long as little information on the course of NAA10-related N-terminal-acetyltransferase defi-ciency in females is available, general recommendations for cardiac conduction anomalies such as long-QT syndrome might be ap-plied. One should also consider electrocardiographic examination in otherwise asymptomatic female carriers in families with X-linked recessive NAA10-related N-terminal-acetyltransferase deficiency, as conduction anomalies might occur as a minimal manifestation of the disease in them, similar to cardiomyopathies in female carriers of Duchenne muscular dystrophy [Hoogerwaard et al., 1999].
Figure 3. Functional consequences of NAA10 mutations. A: Purified wild-type (WT) or mutant NAA10 were each mixed with acetylation buffer, 500μM peptide and 500 μM Ac-CoA, and incubated at 37°C. Reactions were stopped in the linear phase of the reaction. The p.(Arg83Cys) mutation resulted in an approximately 60% reduction in catalytic activity of NAA10 for all tested oligopeptides, whereas the p.(Phe128Leu) mutation lead to a very low catalytic activity (more than 90% reduction). B–E: NAA10 stability in vivo, tested pairwise (mutant and control) by cyclohexamide chase experiments and monitored at different time points (between 0 and 6 hr post-treatment) and by Western blotting. Figures show representative results from at least three independent experiments. B: Western blot for NAA10-V5 WT or NAA10-V5 carrying the mutation p.(Arg83C). Bands were quantified, and the relative amount of NAA10 present at each time point is showed in (C). D: Western blot for NAA10-V5 WT or NAA10-V5 carrying the mutation p.(Phe128Leu). Bands were quantified, and the relative amount of NAA10 present at each time point is showed in (E).
Genotype–Phenotype Correlations
Developmental delay and intellectual disability, postnatal growth failure, and cardiac and skeletal anomalies are overlapping clinical aspects between male individuals with X-linked recessive Ogden syndrome and syndromic microphthalmia and with males or females with severe ID due to de novo mutations in NAA10. These features therefore probably represent general clinical consequences of NAA10-related N-terminal acetylation deficiency. We therefore suggest using this or the shorter term “NAA10 deficiency” to describe the associated phenotypes instead of splitting them into different syndromic entities. The more specific aspects such as aged appearance or wrinkled skin in Ogden syndrome [Rope
et al., 2011], anophthalmia, seizures, and syndactyly in syndromic microphthalmia [Esmailpour et al., 2014] or a rather mild phe-notype in two brothers with mild to moderate ID, scoliosis, and long-QT [Casey et al., 2015] might be related to specific effects of the respective, causative mutations.
Different levels of remaining enzymatic activity and specifically affected properties of NAA10 function were reported for different NAA10 mutations [Esmailpour et al., 2014; Aksnes et al., 2015; Casey et al., 2015; Dorfel and Lyon, 2015; Popp et al., 2015]. In the family with syndromic microphthalmia due to a splice-site
mutation (c.471+2T>A), absent expression of WT NAA10 in
fibroblasts derived from affected individuals and only minimal expression of mutant NAA10 was shown [Esmailpour et al., 2014].
For the p.(Ser37Pro) mutation from the Ogden syndrome families, disruption of the catalytic activity was confirmed [Rope et al., 2011]. Furthermore, the integrity of the NatA complex was disturbed and N-terminal acetylome analyses of B-cells, and fibroblasts from affected individuals revealed a reduction of the NatA-mediated N-terminal acetylation [Van Damme et al., 2014; Myklebust et al., 2015]. In contrast, the de novo p.(Arg116Trp) mutation resulted in a high remaining catalytic activity, therefore being in accordance with the relatively mild phenotype in the affected boy [Popp et al., 2015], whereas the de novo p.(Val107Phe) mutation, identified in a girl, had a more severe effect with almost abolished catalytic activity, thus explaining the pronounced manifestation of symptoms in a female [Popp et al., 2015].
However, the hypothesis of phenotypic severity correlating with levels of catalytic activity is challenged by a report on two affected brothers with a rather mild phenotype but carrying a mutation with a severe impact on catalytic activity [Casey et al., 2015].
Our functional studies, comparing all de novo missense mu-tations identified in females, show that the p.(Phe128Leu) and the p.(Phe128Ile) mutations cause a reduced stability of NAA10 and loss of NAA10 NAT-activity. Based on the close proximity of Phe128 and Val107 in the NAA10 structure, our data suggest that individuals with either mutation might be affected through the same molecular mechanisms. The p.(Arg83Cys) mutation also has a
clearly reduced catalytic activity, due to a lower affinity for AC–CoA,
but does not seem to affect NAA10 structurally. The homogenous phenotype in all girls with either the p.(Val107Phe), p.(Phe128Leu), p.(Phe128Ile), or p.(Arg83Cys) mutation suggests that rather the loss of the NAT activity, which is shared by all missense mutations, and not the impaired structural stability, found for all but the p.(Arg83Cys) mutation, is underlying their similar phenotype. The milder catalytic impairment by the p.(Arg83Cys) mutation
of 60% compared to a>90% abolishment of catalytic activity by
p.(Phe128Leu) or the previously published p.(Val107Phe) variant is not reflected in an obviously milder clinical phenotype in the respective individuals, suggesting a critical threshold of enzyme ac-tivity necessary for normal function. This critical threshold might, however, be met by individual 2. She showed a milder phenotype with an IQ of 50 and no postnatal growth deficiency. This girl carries the mutation p.(Arg116Trp), that has previously been shown to result in a rather mild reduction of NAA10 catalytic activity [Popp et al., 2015].
According to the observation of the p.(Arg116Trp) mutation caus-ing a more severe phenotype in a male [Popp et al., 2015] compared to the herewith reported female, also the other missense mutations might have a significantly more pronounced effect in males, possibly leading to lethality. This would be in accordance with the observa-tion in family 12, in which the affected boy deceased 1 week after birth. Nevertheless, the contrast between the severe ID and micro-cephaly phenotypes in the herewith reported females with mainly de novo mutations in NAA10 and the mostly asymptomatic carrier fe-males in families with Ogden and Lenz microphthalmia syndromes is still striking. A possible cause might be the X-inactivation pattern. Its possible impact on the phenotype is reflected in Individual 11. This girl has an 100% skewed X-inactivation in lymphocytes and is the only individual carrying the p.(Arg83Cys) mutation but not showing microcephaly or postnatal growth retardation. In contrast, X-inactivation was random in lymphocytes of four of the other five tested females in our study and only mildly skewed in the fifth. All carrier females in the original Ogden syndrome family were reported to have skewed X-inactivation, which would be in accordance with them not showing any or only mild symptoms [Myklebust et al., 2015]. However, an explanation why skewing of X-inactivation
oc-curred in the females with inherited mutations and only twice in the females with de novo mutations and still causing a severe pheno-type, is still lacking. As NAA10-related N-terminal acetyltransferase deficiency seems to be caused by different mutations and to be accompanied by various phenotypes, there might be tissue speci-ficity or a correlation between specific mutations and skewing or nonskewing of X-inactivation.
De novo mutations in X-linked recessive genes in females The relatively high number of 12 individuals indicates that mis-sense mutations affecting the catalytic activity of X-chromosomal encoded NAA10 might be a relatively frequent cause of severe ID in females. Similar observations of de novo mutations in X-linked genes causing severe ID phenotypes in females while female carriers of mu-tations in families with affected males were normal, were recently made for other genes such as DDX3X (MIM# 300160) [Snijders Blok et al., 2015] or PHF6 (MIM# 300414) [Zweier et al., 2013]. We therefore hypothesize that de novo mutations in supposedly X-linked recessive genes might be more common than previously expected.
To conclude, our findings show that different missense muta-tions in NAA10 in females result in severe ID and postnatal growth failure with severe microcephaly and thus expand the clinical and mutational spectrum associated with X-linked NAA10 related N-terminal-acetyltransferase deficiency. Particularly the observation of cardiac conduction anomalies in both males and females has relevant consequences for the clinical management of known and newly identified individuals.
Acknowledgments
We thank the families for their participation. The authors would like to thank the NHLBI GO Exome Sequencing Project and its ongoing studies that pro-duced and provided exome variant calls for comparison: the Lung GO Se-quencing Project (HL-102923), the WHI SeSe-quencing Project (HL-102924), the Broad GO Sequencing Project (HL-102925), the Seattle GO Sequencing Project (HL-102926), and the Heart GO Sequencing Project (HL-103010).
Disclosure statement: The authors have no conflict of interests to declare.
References
Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. 2010. A method and server for predicting damaging missense mutations. Nat Methods 7:248–249.
Aksnes H, Hole K, Arnesen T. 2015. Molecular, cellular, and physiological significance of N-terminal acetylation. Int Rev Cell Mol Biol 316:267–305.
Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. 1992. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 51:1229–1239.
Arnesen T, Anderson D, Baldersheim C, Lanotte M, Varhaug JE, Lillehaug JR. 2005. Identification and characterization of the human ARD1-NATH protein acetyl-transferase complex. Biochem J 386:433–443.
Arnesen T, Van Damme P, Polevoda B, Helsens K, Evjenth R, Colaert N, Varhaug JE, Vandekerckhove J, Lillehaug JR, Sherman F, Gevaert K. 2009. Proteomics analyses reveal the evolutionary conservation and divergence of N-terminal acetyltrans-ferases from yeast and humans. Proc Natl Acad Sci U S A 106:8157–8162. Behnia R, Panic B, Whyte JR, Munro S. 2004. Targeting of the Arf-like GTPase Arl3p to
the Golgi requires N-terminal acetylation and the membrane protein Sys1p. Nat Cell Biol 6:405–413.
Casey JP, Stove SI, McGorrian C, Galvin J, Blenski M, Dunne A, Ennis S, Brett F, King MD, Arnesen T, Lynch SA. 2015. NAA10 mutation causing a novel intellectual dis-ability syndrome with Long QT due to N-terminal acetyltransferase impairment. Sci Rep 5:16022.
Dorfel MJ, Lyon GJ. 2015. The biological functions of Naa10—from amino-terminal acetylation to human disease. Gene 567:103–131.
Esmailpour T, Riazifar H, Liu L, Donkervoort S, Huang VH, Madaan S, Shoucri BM, Busch A, Wu J, Towbin A, Chadwick RB, Sequeira A, et al. 2014. A splice donor mutation in NAA10 results in the dysregulation of the retinoic acid sig-nalling pathway and causes Lenz microphthalmia syndrome. J Med Genet 51:185– 196.
Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen MY, Pieper U, Sali A. 2007. Comparative protein structure modeling using MODELLER. Curr Protoc Protein Sci Chapter 2:Unit 2:9.
Evjenth R, Hole K, Ziegler M, Lillehaug JR. 2009. Application of reverse-phase HPLC to quantify oligopeptide acetylation eliminates interference from unspecific acetyl CoA hydrolysis. BMC Proc 3 Suppl 6:S5.
Forte GM, Pool MR, Stirling CJ. 2011. N-terminal acetylation inhibits protein targeting to the endoplasmic reticulum. PLoS Biol 9:e1001073.
Holmes WM, Mannakee BK, Gutenkunst RN, Serio TR. 2014. Loss of amino-terminal acetylation suppresses a prion phenotype by modulating global protein folding. Nat Commun 5:4383.
Hoogerwaard EM, Bakker E, Ippel PF, Oosterwijk JC, Majoor-Krakauer DF, Leschot NJ, Van Essen AJ, Brunner HG, van der Wouw PA, Wilde AA, de Visser M. 1999. Signs and symptoms of Duchenne muscular dystrophy and Becker muscular dystrophy among carriers in The Netherlands: a cohort study. Lancet 353:2116–2119. Kumar P, Henikoff S, Ng PC. 2009. Predicting the effects of coding non-synonymous
variants on protein function using the SIFT algorithm. Nat Protoc 4:1073–1081. Lau AW, Brown CJ, Penaherrera M, Langlois S, Kalousek DK, Robinson WP. 1997.
Skewed X-chromosome inactivation is common in fetuses or newborns associated with confined placental mosaicism. Am J Hum Genet 61:1353–1361.
Lek M, Karczewski K, Minikel E, Samocha K, Banks E, Fennell T, O’Donnell-Luria A, Ware J, Hill A, Cummings B, Tukiainen T, Birnbaum D, et al. 2015. Analysis of protein-coding genetic variation in 60,706 humans. bioRxiv. http://dx.doi.org/10.1101/030338
Liszczak G, Goldberg JM, Foyn H, Petersson EJ, Arnesen T, Marmorstein R. 2013. Molecular basis for N-terminal acetylation by the heterodimeric NatA complex. Nat Struct Mol Biol 20:1098–1105.
Mullen JR, Kayne PS, Moerschell RP, Tsunasawa S, Gribskov M, Colavito-Shepanski M, Grunstein M, Sherman F, Sternglanz R. 1989. Identification and characterization of genes and mutants for an N-terminal acetyltransferase from yeast. EMBO J 8:2067–2075.
Myklebust LM, Van Damme P, Stove SI, Dorfel MJ, Abboud A, Kalvik TV, Grauffel C, Jonckheere V, Wu Y, Swensen J, Kaasa H, Liszczak G, et al. 2015. Biochemical and cellular analysis of Ogden syndrome reveals downstream Nt-acetylation defects. Hum Mol Genet 24:1956–1976.
Popp B, Stove SI, Endele S, Myklebust LM, Hoyer J, Sticht H, Azzarello-Burri S, Rauch A, Arnesen T, Reis A. 2015. De novo missense mutations in the NAA10 gene cause
severe non-syndromic developmental delay in males and females. Eur J Hum Genet 23:602–609.
Rauch A, Wieczorek D, Graf E, Wieland T, Endele S, Schwarzmayr T, Albrecht B, Bartholdi D, Beygo J, Di Donato N, Dufke A, Cremer K, et al. 2012. Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study. Lancet 380:1674–1682.
Redin C, Gerard B, Lauer J, Herenger Y, Muller J, Quartier A, Masurel-Paulet A, Willems M, Lesca G, El-Chehadeh S, Le Gras S, Vicaire S, et al. 2014. Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing. J Med Genet 51:724–736.
Rope AF, Wang K, Evjenth R, Xing J, Johnston JJ, Swensen JJ, Johnson WE, Moore B, Huff CD, Bird LM, Carey JC, Opitz JM, et al. 2011. Using VAAST to identify an X-linked disorder resulting in lethality in male infants due to N-terminal acetyltransferase deficiency. Am J Hum Genet 89:28–43.
Schwarz JM, Cooper DN, Schuelke M, Seelow D. 2014. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods 11:361–362.
Scott DC, Monda JK, Bennett EJ, Harper JW, Schulman BA. 2011. N-terminal acetyla-tion acts as an avidity enhancer within an interconnected multiprotein complex. Science 334:674–678.
Setty SR, Strochlic TI, Tong AH, Boone C, Burd CG. 2004. Golgi targeting of ARF-like GTPase Arl3p requires its Nalpha-acetylation and the integral membrane protein Sys1p. Nat Cell Biol 6:414–419.
Shemorry A, Hwang CS, Varshavsky A. 2013. Control of protein quality and stoichiome-tries by N-terminal acetylation and the N-end rule pathway. Mol Cell 50:540–551. Snijders Blok L, Madsen E, Juusola J, Gilissen C, Baralle D, Reijnders MR, Venselaar H, Helsmoortel C, Cho MT, Hoischen A, Vissers LE, Koemans TS, et al. 2015. Mutations in DDX3X are a common cause of unexplained intellectual disability with gender-specific effects on Wnt signaling. Am J Hum Genet 97:343–352. Thevenon J, Duffourd Y, Masurel-Paulet A, Lefebvre M, Feillet F, El Chehadeh-Djebbar
S, St-Onge J, Steinmetz A, Huet F, Chouchane M, Darmency-Stamboul V, Callier P, et al. 2016. Diagnostic odyssey in severe neurodevelopmental disorders: to-wards clinical whole-exome sequencing as a first-line diagnostic test. Clin Genet. 10.1111/cge.12732
Thompson PR, Wang D, Wang L, Fulco M, Pediconi N, Zhang D, An W, Ge Q, Roeder RG, Wong J, Levrero M, Sartorelli V, et al. 2004. Regulation of the p300 HAT domain via a novel activation loop. Nat Struct Mol Biol 11:308–315.
Van Damme P, Stove SI, Glomnes N, Gevaert K, Arnesen T. 2014. A Saccharomyces cerevisiae model reveals in vivo functional impairment of the Ogden syndrome N-terminal acetyltransferase NAA10 Ser37Pro mutant. Mol Cell Proteomics 13:2031– 2041.
Zweier C, Kraus C, Brueton L, Cole T, Degenhardt F, Engels H, Gillessen-Kaesbach G, Graul-Neumann L, Horn D, Hoyer J, Just W, Rauch A, et al. 2013. A new face of Borjeson-Forssman-Lehmann syndrome? De novo mutations in PHF6 in seven females with a distinct phenotype. J Med Genet 50:838–847.
