Sensitivity of intestinal fibroblasts to TNF-Related Apoptosis-Inducing Ligand mediated apoptosis in Crohn’s disease.
Short title: TRAIL and apoptosis in Crohn’s disease
C. Reenaers 1,3, N. Franchimont 2,3, C. Oury 3, J. Belaiche 1, M. Malaise2, 3,V Bours 3,
E. Theatre, P. Delvenne 4, E. Louis 1,3
Gastroenterology department (1), Rheumatology department (2), Centre for Cellular and
Molecular Therapy, GIGA Research (3), Pathology Department (4), University of Liège, CHU
Sart-Tilman, 4000 Liège, Belgium.
Corresponding author:
Edouard Louis, M.D., Ph.D.
Gastroenterology, CHU Sart-Tilman,
4000 Liège, Belgium
TEL: 32 4 366 72 56
FAX: 32 4 36678 89
e-mail: edouard.louis@ulg.ac.be
Key words: Crohn’s disease, TNF-Related Apoptosis-Inducing Ligand, human intestinal
fibroblasts, apoptosis
Abbreviations: Crohn’s disease (CD), Tumor Necrosis Factor- -Related Apoptosis-Inducing Ligand (TRAIL), Human intestinal Fibroblasts (IF), Osteoprotegerin (OPG), Receptor
Activator of NF-B (RANK), Receptor Activator of NF-B ligand (RANKL), Tumor Necrosis Factor (TNF), Interleukin (IL), Ulcerative Colitis (UC), Inflammatory Bowel
Abstract
Background: Strictures and fistulas are common complications of Crohn’s disease (CD).
Collagen deposit and fibroblasts proliferation may contribute to their development.
TNF-related apoptosis-inducing ligand (TRAIL) binds two pro-apoptotic (TRAIL-R1, TRAIL-R2)
and three anti-apoptotic (TRAIL-R3, TRAIL-R4, OPG) receptors. The aim of our work was
to study TRAIL expression and effects on intestinal fibroblast (IF) in CD. Methods: Intestinal
samples from 25 CD (with fibrostenosing areas or not) and 38 control patients (with
inflammation or not) were used. TRAIL, TRAIL R2 and TRAIL R3 expression in the
intestine and in human IF was studied by real time RT-PCR and immunostaining in IF and
intestinal samples. TRAIL-induced IF cell death was studied in the presence or absence of
OPG and cytokines. Western Blots for PARP and caspase 8 were performed to confirm
apoptosis in IF. Results: Transcripts for TRAIL and its receptors were confirmed in the
intestine. Immunostaining showed an intestinal expression of TRAIL, TRAIL-R2 and
TRAIL-R3 in fibroblasts, immune cells and epithelial cells, mainly in fibrostenosing areas.
TRAIL-R3 mRNA expression was lower in IF from fibrostenosing CD. The sensitivity of IF
to TRAIL mediated apoptosis was higher in fibrostenosing areas of CD. The effect of TRAIL
was decreased by IL-6 and its soluble receptor and almost completely reversed by OPG in
involved CD. Conclusion: TRAIL is expressed in the intestine and influences fibroblast
survival. Variations in TRAIL expression and in TRAIL mediated apoptosis could be
Introduction
Crohn’s disease (CD) is a chronic inflammatory bowel disease (IBD) of the
gastrointestinal tract characterized by a transmural inflammation due to an imbalance between
pro and anti-inflammatory processes. An increased production of pro-inflammatory cytokines
including IL-1, Tumor Necrosis Factor alpha (TNFα), IL-6 and IL-12 has been described,
leading to activation and apoptosis resistance of immune cells, mainly T cells and antigen
presenting cells (1-3). Fibrosis and strictures are common complications in CD. They are
thought to be a result of uncontrolled wound healing (4, 5). Fibroblast functions are tightly
regulated by cytokines that are secreted both by inflammatory cells and neighbouring
fibroblasts (6-8). In pathological conditions, the normal wound healing becomes uncontrolled
and followed by excessive deposition of collagen in the surrounding extracellular matrix.
Troubles of fibroblasts metabolism in fibrotic tissue including excessive fibroblasts
accumulation, expression of profibrotic growth factors and adhesion molecules also seems to
be involved in tissue remedoling taking place in CD. (4, 9-11).
TNF-Related Apoptosis Inducing Ligand (TRAIL), also called Apo-2 ligand, is a
member of the TNF superfamily showing high homology with CD95L (13). TRAIL is
expressed as a type 2 transmembrane protein but its extracellular domain can be
proteolytically cleaved from the cell surface into a soluble form. The unique feature originally
attributed to TRAIL was selective apoptosis of tumoral or transformed cells (13, 14). More
recently, it has been shown that TRAIL induces apoptosis of normal cells such as hepatocytes
(15), virus-infected cells (16), autoreactive immune cells (17), epithelial cells (18), suggesting
the potential pathogenic role of TRAIL in other conditions linked to cell death such as
inflammation and autoimmunity. TRAIL triggers apoptosis by binding 2 pro-apoptotic
receptors, TRAIL-R1 also called DR4 (19), and TRAIL-R2 also called DR5 (20-24). Binding
signalling complex (DISC) and in the activation of the caspase 8 and 10 (25-26). In addition
to the agonist receptors, TRAIL can bind TRAIL-R3 and TRAIL-R4 that are non-signalling
decoy receptors because they do not contain an intact death domain (23, 27). Osteoprotegerin
(OPG) has been reported as the fifth receptor which acts as a soluble decoy receptor for
TRAIL (28) but also for the Receptor Activator of NF-kB Ligand (RANKL) a ligand
controlling bone resorption and to a lesser extent immune functions (29, 30, 31). Increased
levels of OPG were recently detected in the intestine of CD patients (32) but the role of
TRAIL-TRAIL receptors system in the gut has not been studied extensively. A recent study
shows the expression of TRAIL and its receptors in normal gut and IBD (33) mainly in
lamina propria mononuclear cells and in intestinal epithelial cells. TRAIL and TRAIL-R2
expression in intestinal epithelial cells was upregulated in active CD, suggesting a role in
epithelium damage by an induction of apoptosis in epithelial cells. Whether or not OPG, a
protein produced in the colon of CD patients, could influence TRAIL-induced apoptosis is not
known at the present time.
The aims of our work were to study intestinal expression of TRAIL and its receptors
in CD, to test the viability of human intestinal fibroblasts (IF) in response to TRAIL in
different conditions and to compare it to IF isolated from patient tissues with inflammatory
and non inflammatory bowel pathology.
Material and methods
Overall, tissue samples from 25 CD patients and 38 inflammatory or non inflammatory
control patients were used for the different experiments performed in the present work.
Diagnosis of CD was established on the basis of classical clinical, radiological, endoscopic
and histological criteria. The tissue samples came either from surgical resection specimens or
experiments are detailed in the following sections. The study protocol was approved by the
institutional ethic committee of the university of Liège and informed consent was obtained
from all patients.
RT-PCR
Intestinal tissues were obtained from fibrostenosing CD (n=9, including 4 from the
ileocaecal anastomosis, 3 from the ileum, 2 from the colon), non fibrostenosing CD (n=4,
including 2 from the ileum and 2 from the colon) and non inflammatory controls (normal
colon at distance of colon cancer; n=8) who required surgery for the treatment of their
disease. Total cellular RNA was extracted by RNeasy Kit according to manufacturer’s
instructions (Qiagen, Chatsworth, CA, USA). The RNA recovered was quantitated by
spectrophotometry (Gene Quant, Pharmacia, Peapack, USA), digested with DNase I (Roche
Diagnostics, Vilvoorde, Belgium) and 500 ng of RNA was subjected to reverse transcription
using the First Strand cDNA Synthesis kit (Roche, Mannheim, Germany). RT-PCR for tissues
and Real-time RT-PCR for IF were carried out on a TaqMan platform using SYBR Green
reagent (Applied Biosystems, Foster city, CA) as described previously (34). Primers were
designed using the Primer Express software (Invitrogen, Merelbeke, Belgium) (Table 2). The
number of transcripts were normalized with the housekeeping gene 2-microglobulin.
Immunostaining for TRAIL, TRAIL-R2 and TRAIL-R3 expression in the gut
Samples used for immunostaining were obtained from surgical resections but also
from biopsies performed during endoscopic procedures: 11 non-inflammatory controls
isolated from the colon, , 22 fibrostenosing CD (15 from the ileum, 7 from the colon), 16
non-fibrostenosing CD (10 from trhe ileum, 6 from the colon), 12 active UC, 9 diverticulitis).
were included in the same group because of preliminary results showing no differences
according to the location of the disease. Paraffin-embeded intestinal tissue sections were
stained for TRAIL, TRAIL-R2 and TRAIL-R3 (monoclonal anti-human TRAIL antibody
1:20, clone 75402; monoclonal anti-human TRAIL-R2 antibody 1:20, clone 71908;
monoclonal anti-TRAIL-R3 antibody 1:20, clone 90905; R&D system, Abingdon, UK) using
the DAB method, as previously described in detail (35). The density of positive cells was
determined by selecting 5 fields in the most positive regions of each section and by counting
the number of positive cells per field at 400X magnification. The mean value was then
calculated and recorded for each section (36).
Fibroblasts isolation
Intestinal tissues were obtained from the mucosa and submucosa of patients who
required surgery for a fibrostenosing CD (n=9). Tissue was also collected in non
fibrostenosing areas in these patients (n=8). Histological analysis of fibrostenosing samples
revealed thickening of the bowel wall with fibrosis, inflammation and ulcers. Samples from
CD patients were obtained from ileum, colon and ileocaecal anastomosis and were included in
the same group because of preliminary results showing no differences according to the
location of the disease. Samples from non inflammatory controls were obtained from patients
who required surgery for cancer or diverticulitis and tissue was collected in non inflammatory
and non tumoral area according to histological criteria (n=7). Characteristics of the CD
patients are shown in table 1..Mucosal and submucosal fibroblasts were obtained from
transparietal intestinal samples dissected from the intestinal surgical resections. Intestinal
tissue were dissected into 0,5 mm pieces (explants). Explants were placed onto culture dishes.
Cultures medium comprised 500 ml DMEM, 1% L-Glutamine, 1% penicillin, 1%
Cambrex Biosciences, Verviers, Belgium). All cultures were incubated for 3 weeks until
reaching confluence and then trypsinised (trypsin ethylene diamine tetraacetic acid 1%) and
transferred onto cultured flask. To avoid changes in fibroblast phenotype from prolonged in
vitro culture, cells were studied between the first and the fifth passages.
.
Characterization of IF
IF were characterized on the basis of cellular morphology and immunohistochemical staining.
For immunohistochemical characterization, 20000 cells were seeded onto LabTek Chamber
slides (BD Biosciences, Erembodegem, Belgium). The cells were fixed with ice-cold acetone.
All immunocytochemical staining were performed according to the manufacturer protocol.
The following antibodies were used: anti-vimentin (1:5000; Dako, Glostrup, Denmark),
anti-desmin (1:500, Dako, Glostrup, Denmark), anti- alpha-smooth muscle actin (1:200, Dako,
Glostrup, Denmark). Immunostaining of IF cultured on LabTek Chamber slides for TRAIL,
TRAIL-R2 and TRAIL-R3 was also performed according to the manufacturer protocol with
the same primary antibodies, at the same concentration and incubation time as the one
previously for the tissue samples. Negative controls which consist to omit the primary
antibody were performed for each antibody tested and gave the expected results.
IF viability
100 microliters of fibroblast suspension, at a cell density of 2 X 105 cells /ml, were
plated into 96 well culture plates with culture medium comprising 1 or 10 % fetal calf serum.
Cells were cultured during 24 hours at 37°C in a humidified 5% CO2, 95% air incubator and
then stimulated for 24 hours with increasing doses (from 10 to 500 ng/ml) of recombinant
deprivation (FCS 10% and 1% respectively). IF were pretreated during 24 hours with various
cytokines at a concentration of 10 ng/ml (recombinant IL-1 β, TNF α, IL-6 + IL6-SR, IL-10,
from R&D system, Abingdon, UK) and then treated with TRAIL (in conditions giving
optimal apoptosis induction: 50 ng/ml with FCS 1%). We also cultured IF with FCS 1% in the
presence or absence of increasing doses (from 100 to 5000 ng/ml) of recombinant human
OPG (R&D system, Abingdon, UK) for 24 hours before TRAIL (50 ng/ml) treatment. Cell viability was assessed by reduction of the methyl tetrazolium salt (MTS) to the formazan product in viable cells (“cellTiter 96®Aqueous”; Promega,
Madison, WI) as described previously (37). Results were expressed as the percent of the viability measured in untreated cells (100% viability).
Western Blotting to assess apoptosis in IF
IF were treated for 4 hours with TRAIL 50 ng/ml and FCS 1% in the presence or
absence of OPG (1000 ng/ml) added concomitantly to the cell cultures. IF were collected after
TRAIL treatment and lysed. The totalproteins were separated by SDS-PAGE as described
previously (38). Caspase 8 was detected with rabbit polyclonal antibody (Pharmingen,
Erembodegem, Belgium) diluted 1:100. Poly ADP-ribose Polymerase (PARP) was detected
with mousemonoclonal antibody (Pharmingen, Erembodegem, Belgium), diluted 1:1000 and
beta-actinwas detected with mouse monoclonal antibody (Sigma), diluted1:1000. Incubation
of membranes with primary antibodieswas done at room temperature for 1–3 h. Western blots
were revealed with 1:2000 diluted anti-mouse and anti-rabbit antibodies (DAKO A/S,
Glostrup, Denmark) and ECL chemiluminescent reagents (Amersham Biosciences, Little
Chalfont Buckinghamshire, UK).
All the data are expressed as mean +/- standard error (SEM). The Student t test was used for evaluation of parametric data, whereas the Wilcoxon signed rank test was used for evaluation of non parametric data to study the influence of TRAIL, cytokine and OPG on IF survival. The number of TRAIL-positive labelled cells/field in the intestine was compared by the Kruskal Wallis test. To compare mean value between different groups, one-way analysis of variance (ANOVA) or a Kruskal Wallis test were performed when the distribution of data was normal or had high variability respectively. All results were considered to be significant at the 5% critical level (p<0.05).
Results
TRAIL, TRAIL R2 and TRAIL R3 expression in the intestinal wall
Trancripts of TRAIL, TRAIL-R2 and TRAIL-R3 were detected in the intestine of
control, fibrostenosing and non-fibrostenosing CD (data not shown). Under non inflammatory
conditions, TRAIL immunostaining was detected in the intestinal mucosa (Figures 1A, 1B) in
a few inflammatory cells in the lamina propria or lymphoid follicules. In fibrostenonsing CD areas, the density of TRAIL-positive inflammatory cells was significantly higher than in non
inflammatory controls or non-fibrostenosing CD tissues (p=0,0003) (Figure 1C). A high
number of TRAIL-positive cells were also found in inflammatory controls (data not shown).
The majority of TRAIL-positive cells had morphology of inflammatory mononuclear cells
and were observed within the lamina propria (Figure 1E). Lamina propria mononuclear cells
also stained positive for TRAIL-R2 and TRAIL-R3, particularly in fibrostenosing CD but also
in UC and diverticulitis samples (data not shown). No difference was found between CD and
other inflammatory controls. Fibroblasts were also sporadically positive for TRAIL (Figure
and control. A high expression of TRAIL and its receptors was also found in the muscularis
mucosae. No staining was observed in the muscularis propria. Immunohistochemistry also
revealed TRAIL and TRAIL-R2 expression in intestinal epithelial cells. The number of
positive cells was increased in inflammatory intestinal sections compared to normal control
tissues.
Immunohistochemichal characterization of isolated IF
Vimentin, a cytoplasmic intermediate filament protein detected in fibroblasts (39, 40),
was found in 100% of the cells of each culture (Figure 2A). The smooth-muscle actin was
detected in 5 to 10 % of the cells (Figure 2C). Desmin, also a smooth muscle cell marker, was
detected in 10 to 20% of the cells (Figure 2B). These values were similar to those previously
described in the literature (11, 41). TRAIL (Figure 2D), R2 (Figure 2E) and
TRAIL-R3 (Figure 2F) were detected in 100% of the cells from fibrostenosing CD,
non-fibrostenosing CD and controls showing a homogeneous expression of this factor and its
receptors in IF. No staining was observed when the primary antibody was omitted (Figure
2G).
IF survival after TRAIL stimulation
In fibrostenosing CD group, a significant decrease in the fibroblast survival was
observed even with low doses of TRAIL from 10 ng/ml with FCS 1% (Table 3a) and 10%
(Table 3b). In non-fibrostenosing CD group, a significant decrease of IF viability occurred
also with low doses of TRAIL, from 10 and 50 ng/ml, with FCS 1% (Table 3a) and 10 %
(Table 3b) respectively. When comparing fibrostenosing and non-fibrostenosing CD, the
fibroblast death was significantly higher in fibrostenosing CD, compared to
difference was observed between the 3 groups with higher doses of TRAIL. In control group,
higher doses of TRAIL were required to induce a significant decrease of the cell survival
(Table 3a and 3b).
Influence of pro and anti-inflammatory cytokines on cell viability after TRAIL stimulation
In pro-inflammatory conditions, corresponding to stimulation with IL-1, TNF α or IL-6+SR at a dose of 10 ng/ml, a significant increase of IF survival was observed in non-fibrostenosing CD compared to the survival of IF only treated with TRAIL 50 ng/ml. Only IL6+SR was able to increase IF survival in fibrostenosing CD. The pro-survival effect of IL6+SR in the case of TRAIL stimulation was significantly higher in fibrostenosing CD group compared to non-fibrostenosing CD group. No effect of IL10 was observed in CD. In control group, no significant cytokine effect on IF viability was observed compared to treatment with TRAIL 50 ng/ml in the absence of cytokines. (Table 4)
Influence of OPG on cell viability after TRAIL stimulation
In control IF, OPG, even at high doses, did not modify significantly TRAIL-induced
apoptosis. In non-fibrostenosing CD, a higher viability of IF was observed in presence of
OPG 500 to 5000 ng/ml compared to IF viability in presence of TRAIL 50 ng/ml alone. In
fibrostenosing CD IF, in presence of OPG 1000 to 5000 ng/ml, a significant increased
survival was induced compared to stimulation with TRAIL 50 ng/ml alone. High doses of
OPG (5000 ng/ml) completely inhibited the TRAIL mediated apoptosis. With 1000 ng/ml, the
% of cell survival in fibrostenosing CD group reached the one of control group in the case of
Study of the IF apoptosis
Pro-caspase 8 and PARP were constitutively expressed inIF. Upon TRAIL treatment,
caspase-8 and PARP cleavage was observed confirming that TRAIL induces apoptosis in IF
(Figure 4 A and B). In the presence of OPG, the cleavage of PARP was inhibited indicating
that OPG effectively blocks TRAIL-induced apoptosis (Figure 4B).
Decreased TRAIL-R3 mRNA expression in IF from I CD
There was a constitutive mRNA expression of TRAIL and TRAIL-R2 in IF but no
difference was observed between controls, non-fibrostenosing and fibrostenosing CD (Figures
5A, 5B). TRAIL-R3 mRNA expression was decreased in CD compared to controls.
However, a statistically significant decrease in the anti-apoptotic TRAIL-R3 mRNA
expression was only detected in fibrostenosing CD compared to control (Figure 5C).
Discussion
TRAIL is a pro-apoptotic factor expressed in many tissues including the
gastrointestinal tract (33, 42, 43). However, its role in the gut remains unclear. As previously
described, we report that TRAIL is expressed in the mucosa of the intestine by different cell
types including epithelial cells and immune mononuclear cells from the lamina propria.
TRAIL-R2 and TRAIL-R3 were also expressed in the intestine by epithelial cells and LPMC.
These results were confirmed by RT-PCR, revealing mRNA expression of TRAIL and its
receptors in the bowel. We observed an increased density of cells expressing the protein
TRAIL in areas of intestinal inflammation such as involved CD but this increase was not
disease-specific because no difference was seen between CD and other inflammatory controls
(UC, diverticulitis). These results suggest that TRAIL could act as an important mediator in
Initially, TRAIL was considered as a specific pro-apoptotic factor for tumor cells (13).
Its pro-apoptotic role in non transformed cells was described more recently. Several recent
works showed an expression of TRAIL-R2 and troubles of TRAIL-induced apoptosis in
rheumatoid arthritis synovial fibroblasts (44, 45) but also an excessive deposit of extracellular
matrix in liver (46) and lung (47) due to the TRAIL-TRAIL-R2 interaction. These data
suggest a possible role of TRAIL on the physiology of fibroblasts. Our study reports for the
first time the expression of TRAIL and its receptors TRAIL-R2 and TRAIL-R3 in IF mainly
in the lamina propria and the muscularis mucosae. Fibroblasts expressed TRAIL and its
receptors in controls as well as in inflammatory diseases. IF represent a mixed population of
myofibroblasts (positive for desmin and alpha smooth muscle actine) and fibroblasts (negative
for desmin and alpha smooth muscle actine) retaining their characteristics through isolation
and multiple passages (39, 40). Demonstration of TRAIL immunoreactivity in the gut and
TRAIL-R2 - TRAIL R3 expression by IF led us to test IF sensitivity to TRAIL-mediated
apoptosis. Fibroblasts cell death was evaluated by a non specific technique but confirmation
of apoptosis was verified by caspase-8 and PARP cleavage. We showed in this work that
TRAIL induced apoptosis of IF in non-fibrostenosing and fibrostenosing CD, even using
relatively low concentrations of TRAIL, insufficient to induce apoptosis in tumoral cells (48,
49). In contrast, apoptosis was observed in IF from control only at higher doses of TRAIL
revealing increased sensitivity of CD IF to this pro-apoptotic factor. This difference appeared
clearly with 50 ng/ml of TRAIL while no more difference was observed between the control,
non-fibrostenosing CD and fibrostenosing CD when using higher doses of TRAIL ( ≥500
ng/ml), probably physiologically less relevant. In order to confirm and understand why there
was a tendency to have an apoptosis increase in fibrostenosing CD IF, we studied the
expression of TRAIL receptors. Quantitative real-time PCR demonstrated no difference in
IF from control or CD. However the expression of the anti-apoptotic receptor TRAIL R3 was
significantly downregulated in fibrostenosing CD. This could contribute to the increased cell
death induced by TRAIL in fibrostenosing CD.
In CD, a complex inflammatory cascade occurs in the mucosa and submucosa of the
bowel. In order to reproduce these pro-inflammatory conditions in vitro, influence of pro and
anti-inflammatory cytokines was tested on TRAIL-induced cell death. In non-fibrostenosing
CD, all pro-inflammatory cytokines tested (IL-1, TNF, IL-6+SR) were able to increase IF
viability under TRAIL stimulation. This was not observed in controls. In fibrostenosing CD,
only IL6+SR protected IF from TRAIL-induced apoptosis. Anti-apoptotic properties of IL6
and its soluble receptor have also been described in other cell types such as T cells (50) and
osteoblasts (51) by increasing the imbalance between anti and pro-apoptotic genes.
OPG is a soluble decoy receptor inhibiting the TRAIL-induced apoptosis and is produced in
the human bowel (32).It was recently demonstrated that OPG can inhibit TRAIL-induced
apoptosis of fibroblast-like synovial cells in rheumatoid arthritis (52). It led us to test the
influence of OPG in IF viability under TRAIL stimulation.The highest doses used in this work
corresponded to the minimal concentration of OPG needed to inhibit the TRAIL mediated
apoptosis in some tumoral cells (53, 54). In the present work we reported that OPG could
modify TRAIL-induced IF death in fibrostenosing and non-fibrostenosing CD. Although the
IF from CD were more sensitive to TRAIL-mediated apoptosis, their survival returned to the
same level as in controls in presence of high doses OPG. Moreover, with the highest doses of
OPG (5000 ng/ml), cells survival in CD became higher than in controls suggesting a complete
inhibition of TRAIL-induced apoptosis.
In conclusion, this study describes functional alterations of IF in CD. A higher
sensitivity to TRAIL, particularly in fibrostenosing area, associated with a downregulation of
be found in excess in CD intestine, decreased the IF sensitivity to TRAIL-mediated apoptosis
with nearly 100% of cell survival with high doses of OPG. A modification of fibroblast
survival may be involved in the tissue remodelling associated with Crohn’s disease.
Acknowledgements and affiliations: This work was supported by a grant from the Belgian
National Fund for Scientific Research (FNRS), by an unrestricted Grant from AstraZeneca
Belgium and by a grant from the Léon Fredericq funds at the CHU of Liège. C.Oury, P.
Delvenne and E. Louis are research associates at the.F.N.R.S of Belgium, C. Reenaers and E.
Theatre are research fellow associates at the F.N.R.S. of Belgium. N. Franchimont is now an
employee of Amgen, Europe. The authors did not receive any material or funding from
Amgen. This work has been done independently of Amgen. The authors thank Aline
Desoroux for expert technical assistance. We are indebted to the department of Biostatistics (Professor A. Albert) for statistical assistance.
References
1. Reimund JM, Wittersheim C, Dumont S, Muller CD, Kenney JS, Baumann R, Poindron P,
Duclos B. Increased production of tumor necrosis factor-alfa, interleukin-1 beta, and
interleukin-6 by morphologically normal intestinal biopsies from patients with Crohn’s
disease. Gut 1996; 39: 684-9.
2. Reinecker HC, Steffen M, Witthoeft T, Pflueger I, Schreiber S, Mac Dermott RP, Raedler
A. Enhanced secretion of tumour necrosis factor-alfa, Il-6 and Il-1beta by isolated lamina
propria mononuclear cells from patients with ulcerative colitis and Crohn’s disease. Clin Exp
Immunol 1993; 94: 174-81.
3. Stevens C, Walz G, Singaram C, Lipman ML, Zanker B, Muggia A, Antonioli D,
Peppercorn MA, Strom TB. Tumor necrosis factor-alpha, interleukine-1 beta, and
4. Pucilowska JB, Williams KL, Lund PK. Fibrogenesis. IV. Fibrosis and inflammatory bowel
disease: cellular mediators and animal models. Am J Physiol Gastrointest Liver Physiol 2000;
279(4):G653-9.
5. Hogaboam CM, Snider DP, Collins SM. Activation of T lymphocytes by syngeneic murine
intestinal smooth muscle cells. Gastroenterology 1996; 110: 1456-66.
6. Goebels N, Michaelis D, Wekerle H, Hohlfeld R. Human myofibroblasts as antigen
presenting cells. J Immunol 1992; 149: 661-7.
7. Alexakis C, Caruelle JP, Sezeur A, Cosnes J, Gendre JP, Mosnier H, Beaugerie L, Gallot,
D, Malafosse M, Barritault D, Kern P. Reversal of abnormal collagen production in Crohn’s
disease intestinal biopsies treated with regenerating agents, Gut 2004; 53: 85-90
8. Smith RS, Smith TJ, Blieden TM, Phipps RP. Fibroblasts as sentinel cells. Synthesis of
chemokines and regulation of inflammation. Am J Pathol 1997; 151: 317-22.
9. Dammeier J, Brauchle M, Falk W, et al. Connective tissue growth factors: A novel
regulator of mucosal repair and fibrosis in inflammatory bowel disease? Int J Biochem Cell
Biol 1998; 30: 909-22.
10. Nedelec B, Ghahary A, Scott PG, Tredget EE. Control of wound contraction. Basic and
clinical features. Hand Clin 2000; 16(2):289-302.
11. Gelbmann CM, Mestermann S, Gross V, Köllinger M, Schölmerich J, Falk W. Strictures
in Crohn's disease are characterised by an accumulation of mast cells colocalised with laminin
but not with fibronectin or vitronectin. Gut 1999; 45(2):210-7.
12. Kelly JK, Preshaw RM. Origin of fistulas in Crohn’s disease. J Clin Gastroenterol 1989;
11:193-6.
13. Wiley SR, Schooley K, Smolak PJ, Din WS, Huang CP, Nicholl JK, Sutherland GR,
Smith TD, Rauch C, Smith CA et al. Identification and characterization of a new member of
14. Pitti RM, Marsters SA, Ruppert S, Donahue CJ, Moore A, Ashkenazi A. Induction of
apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J Biol
Chem 1996; 271: 12687-90.
15. Jo M, Kim TH, Soel DW, Esplen JE, Dorko K, Billiar TR, Strom SC. Apoptosis induced
in normal human hepatocytes by tumor necosis factor-related apoptosis-inducing ligand. Nat
Med 2000; 6: 564-67
16. Huang Y, Erdmann N, Peng H, Davis JS, Luo X, Ikezu T, Zheng J. TRAIL-mediated
apoptosis in HIV-1 infected macrophages is dependent on the inhibition of Akt-1
phosphorylation. J Immunol 2006; 177: 2304-13.
17. Kamohara H, Matsuyama W, Shimozato O, Abe K, Galligan C, Hashimoto S,
Matsushima K, Yoshimura T. Regulation of TRAIL and TRAIL receptor expression in human
neutrophils. Immunology 2004; 111: 186-94.
18. Rimondi E, Secchiero P, Quaroni A, Zerbinati C, Capitani S, Zauli G. Involvement of
TRAIL/TRAIL-receptors in human intestinal cell differenciation. J Cell Physiol 2006; 206:
647-54.
19. Pan G, O’Rourke K, Chinnaiyan AM, Gentz R, Ebner R, Ni J, Dixit VM. The receptor for
the cytotoxic ligand TRAIL. Science 1997; 276: 111-113.
20. Pan G, Ni J, Wei YF, Yu G, Gentz R, Dixit VM. An antagonist decoy receptor and a death
domain-containing receptor for TRAIL. Science 1997; 277: 815-18.
21. Screaton GR, Mongkolsapaya J, Xu XN, Cowper AE, McMichael AJ, Bell JI. TRICK2, a
new alternatively spliced receptor that tranduces the cytotoxic signal from TRAIL. Curr Biol
1997; 7: 693-6.
22. Wu G, Burns TF, McDonald ER 3rd, Meng RD, Kao G, Muschel R, Yen T, el-Deiry WS.
KILLER/DR5 is a DNA damage- inducible p53-regulated death receptor gene. Nat Genet
23. Walczak H, Degli-Esposti MA, Johnson RS, Smolak PJ, Waugh JY, Boiani N et al.
TRAIL-R2: A novel apoptosis-mediating receptor for TRAIL . EMBO J 1997; 16: 5386-97.
24. Sheridan JP, Marsters SA, Pitti RM, Gurney A, Skubatch M, Baldwin D, Ramakrishnan
L, Gray CL, Baker K, Wood WI, Goddard AD, Godowski P, Ashkenazi A. Control of
TRAIL-induced apoptosis by a family of signalling and decoy receptors. Science 1997; 277:
818-21.
25. Kischkel FC, Hellbardt S, Behrman I, Germer M, Pawlita M, Krammer PH, Peter ME..
Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death- inducing
signalling complex (DISC) with the receptor. EMBO J 1995; 14: 5579-88.
26. Sprick MR, Weigand MA, Rieser E, Rauch CT, Juo P, Blenis J, Krammer PH, Walczak
H. FADD/MORT1 and caspase-8 are recruited to TRAIL receptors 1 and 2 and are essential
for apoptosis mediated by TRAIL receptor 2. Immunity 2000; 12: 599-609.
27. MacFarlane M, Ahmad M, Srinivasula SM, Fernandes-AlnemriT, Cohen GM, Alnemri
ES. Identification and molecular cloning of two novel receptors for the cytotoxic ligand
TRAIL. J Biol Chem 1997; 272: 25417-20.
28. Emery JG, McDonnell P, Burke MB, Deen KC, Lyn S, Silverman C, Dul E, Appelbaum
ER, Eichman C, DiPrinzio R, Dodds RA, James IE, Rosenberg M, Lee JC, Young PR.
Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J Biol Chem 1998; 273:
14363-7.
29. Cremer I, Dieu-Nosjean MC, Maréchal S, Dezutter-Dambuyant C, Goddard S, Adams D, Winter N, Menetrier-Caux C, Sautès-Fridman C, Fridman WH, Mueller CG. Long-lived
immature dendritic cells mediated by TRANCE–RANK interaction. Blood 2002; 100:3646–55.
30. Josien R, Wong BR, Li HL, Steinman RF, Choi Y. TRANCE, a TNF family member, is differentially expressed on T cell subsets and induces cytokine production in dendritic cells. J Immunol 1999; 162:2562–8.
31. Simonet WS, Lacey DL, Dunstan CR et al. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 1997; 89:309–19.
32. Franchimont N, Reenaers C, Lambert C, Belaiche J, Bours V, Malaise M, Delvenne P,
Louis E. Increased expression of receptor activator of NF-kappaB ligand (RANKL), its
receptor RANK and its decoy receptor osteoprotegerin in the colon of Crohn's disease
patients. Clin Exp Immunol. 2004; 138(3):491-8.
33. Begue B, Wajant H, Bambou JC, Dubuquoy L, Siegmund D, Beaulieu JF, Canioni D,
Berrebi D, Brousse N, Desreumaux P, Schmitz J, Lentze MJ, Goulet O, Cerf-Bensussan N,
Ruemmele FM. Implication of TNF-related apoptosis-inducing ligand in inflammatory
intestinal epithelial lesions. Gastroenterology 2006;130(7):1962-74.
34. Heid CA, Stevens J, Livak KJ, Williams PM: Real time quantitative PCR. Genome Res
1996; 6:986-94
35. Ruemmele FM, Russo P, Beaulieu J, Dionne S, Levy E, Lentze MJ, Seidman EG.
Susceptibility to FAS-induced apoptosis in human nontumoral enterocyte: role of co-stimulatory factors. J Cell Physiol 1999; 181: 45-54.
36. Bosari S, Lee AK, DeLellis RA, Wiley BD, Heatley GJ, Silverman ML. Microvessel quantitation and prognosis in invasive breast carcinoma. Hum Pathol 1992; 23:755–61.
37. Olivier S, Fillet M, Malaise M, Piette J, Bours V, Merville MP, Franchimont N, Sodium nitroprusside-induced osteoblast apoptosis is mediated by long
chain ceramide and is decreased by raloxifene. Biochem Pharmacol 2005; 69(6):891-901
38. Relic B, Benoit V, Franchimont N, Ribbens C, Kaiser MJ, Gillet P, Merville MP, Bours V 15-deoxy-delta12,14-prostaglandin J2 inhibits Bay 11-7085-induced sustained extracellular signal-regulated kinase phosphorylation and apoptosis in human articular
chondrocytes and synovial fibroblasts. J Biol Chem 2004; 279: 22399-403
39. Powell DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI,West AB. Myofibroblasts. I.
Paracrine cells important in health and disese. Am J Physiol 1999; 277: C1-C9.
40. Powell DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI, West AB. Myofibroblasts. II.
Intestinal subepithelial myofibroblasts. Am J Physiol 1999; 277: C183-201.
41. Leeb SN, Vogl D, Gunckel M, Kiessling S, Falk W, Göke M, Schölmerich J, Gelbmann
CM, Rogler G. Reduced migration of fibroblasts in inflammatory bowel disease: role of
inflammatory mediators and focal adhesion kinase. Gastroenterology 2003; 125:1341-54.
42. Strater J, Walczak H, Pukrop T, von Müller L, Hasel C, Kornmann M, Mertens T, Möller
P. TRAIL and its receptors in the colonic epithelium: a putative role in the defense of viral
infection: Gastroenterology 2002; 122:659-666.
43. Koornstra JJ, Kleibeuker JH, van Geelen CM, Rijcken FE, Hollema H, de Vries EG, de
Jong S. Expression of TRAIL (TNF-related apoptosis inducing ligand) and its receptors in
normal colonic mucosa, adenomas, and carcinomas. J Pathol 2003; 200:327-35.
44. Miranda-Carus ME, Balsa A, Benito-Miguel M, De Ayala CP, Martin-Mola E.
Rheumatoid arthritis synovial fluid fibroblasts express TRAIL-R2 (DR5) that is functionally
active. Arthritis Rheum 2004; 50: 2786-93.
45. Ichikawa K, Liu W, Fleck M, Zhang H, Zhao L, Ohtsuka T, Wang Z, Liu D, Mountz JD,
Ohtsuki M, Koopman WJ, Kimberly R, Zhou T. TRAIL R2 (DR5) mediates apoptosis of
46. Mundt B, Wirth T, Zender L, Waltemathe M, Trautwein C, Manns MP, Kuhnel F,
Kubicka S. Tumor necrosis factor related apoptosis inducing ligand (TRAIL) induces hepatic
steatosis in viral hepatitis and after alcohol intake; Gut 2005; 54: 1590-6.
47. Yurovsky VV: Tumor necrosis factor-related apoptosis-inducing ligand enhances collagen
production by human lung fibroblasts. Am J Respir Cell Mol Biol 2003; 28: 225-31
48. Shiiki K, Yoshikawa H, Kinoshita H, Takeda M, Ueno A, Nakajima Y, Tasaka K.
Potential mechanisms of resistance to TRAIL/Apo2L-induced apoptosis in human
promyelocytic leukemia HL-60 cells during granulocytic differenciation. Cell Death Differ
2000; 7: 939-946.
49. Matysiak M, Jurewicz A, Jaskolski D, Selmaj K. TRAIL induces death of
oligodendrocytes isolated from adult brain. Brain 2000; 125: 2469-80.
50. Van Den Brande JM, Peppelenbosch MP, Van Deventer SJ. Treating Crohn's disease by
inducing T lymphocyte apoptosis. Ann N Y Acad Sci 2002; 973:166-80.
51. Franchimont N, Wertz S, Malaise M. Interleukine-6 : An osteotropic factor influencing
bone formation ? Bone 2005; 37: 601-6.
52. Miyashita T, Kawakami A, Nakashima T, Yamasaki S, Tamai M, Kamachi M, Ida H,
Migita K, Origuchi T, Nakao K, Eguchi K. Osteoprotegerin (OPG) acts as an endogenous
decoy receptor in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated
apoptosis of fibroblasts-like synovial cells. Clin Exp Immunol 2004; 137: 430-6.
53. Ingunn Holen, Peter I. Croucher, Freddie C. Hamdy and Colby L. Eaton. Osteoprotegerin (OPG) Is a Survival Factor for Human Prostate Cancer Cells. Cancer Research
2002:1619-1623
54. Osteoprotegerin Is a Soluble Decoy Receptor for Tumor Necrosis Factor-related Apoptosis-inducing Ligand/Apo2 Ligand and Can Function as a Paracrine Survival Factor for Human Myeloma Cells. ShipmanC, and Croucher P. Cancer Research 2003; 63, 912-916
Figure legend
Figure 1. TRAIL immunoperoxydase staining of intestinal tissue specimens. A few lamina
propria mononuclear cells are positive for TRAIL in non inflammatory control (A) and in
non-fibrostenosing CD (B) tissues whereas a significantly higher number of TRAIL positive
immune cells was detected in fibrostenosing CD areas (C). TRAIL was also expressed by
intestinal epithelial cells and its expression was higher in fibrostenosing CD (C) than in
control (A) and non-fibrostenosing CD (B). No staining was observed when the primary
antibody was omitted (D). Higher magnification (1000X) of TRAIL-positive lamina propria
mononuclear cells (E). Higher magnification (1000X) of TRAIL-positive fibroblasts in the
intestinal lamina propria (F). N=70 (22 fibrostenosing CD, 16 non fibrostenosing CD, 11 non
inflammatory controls, 21 inflammatory controls) from 2 independent experiments.
Figure 2. Immunohistochemical analysis of IF culures. Figure 2 shows immunostaining of IF
from fibrostenosing CD. Expression of TRAIL and its receptors by IF in immunostaining was
the same in fibrostenosing CD, non-fibrostenosing CD and controls. Vimentin was expressed
by 100% of IF (Figure 2A) whereas positive staining for desmin (Figure 2B) and alpha
smooth muscle actine (Figure 2C) was observed in 10 to 20 % and 5 to 10 % of IF
respectively. Homogenous expression of TRAIL (D), TRAIL-R2 (E) and TRAIL-R3 (F) by
IF. No immunostaining was observed when the primary antibody was omitted (G). N= 24 (9 fibrostenosing CD, 8 non fibrostenosing CD, 7 non inflammatory controls) from 2 independent experiments.
Figure 3. Role of OPG on IF survival. Results are expressed in % of cell survival (mean +/- SEM) as compared to control condition (no TRAIL or OPG stimulation). A significant increase survival of IF was observed in fibrostenosing (FS) CD when IF were treated with TRAIL 50 ng/ml and OPG from 1000 to 5000 ng/ml compared to treatment with TRAIL 50 ng/ml in
the absence of OPG. In non-fibrostenosing (non-FS) CD, a significant increase of IF survival was observed when cells were treated wilth TRAIL 50 ng/ml and OPG from 500 to 5000 ng/ml compared to treatment with TRAIL 50 ng/ml in absence of OPG. High doses of OPG (5000 ng/ml) completely inhibited the TRAIL mediated apoptosis with 100% of cell survival. No significant effect of OPG on IF survival was observed compared to treatment with TRAIL 50 ng/ml in the absence of OPG in controls. Data represent the means ± SEM of 3 different experiments performed on 24 different individuals (9 fibrostenosing CD, 8 non fibrostenosing CD, 7 non inflammatory controls).
* p< 0,05, ♦ p <0,001.
Figure 4. Study of TRAIL induced apoptosis. IF were treated for 4 hours with TRAIL (50
ng/ml) or with TRAIL (50 ng/ml) and OPG (1000 ng/ml) added simultaneously when
indicated. Western blot detection of PARP, pro-caspase 8 and -actin in total cell extracts. Pro-caspase 8 (A) and PARP (B) cleavage occured during TRAIL-induced apoptosis of IF.
PARP cleavage was inhibited by OPG stimulation (B). N= 14 (5 fibrostenosing CD, 5 non
fibrostenosing CD, 4 non inflammatory controls) from 5 independent experiments.
Figure 5. mRNA expression of TRAIL, TRAIL-R2, TRAIL-R3 in IF. Results are expressed
in relative mRNA expression (mean +/- SEM) and compared to control group. Normalization
was performed by comparison with the 2-microglobulin gene expression. Quantification by real-time RT-PCR of IF from control (n=8), non-fibrostenosing (n=4) or fibrostenosing (n=9)
CD revealed decreased amount of TRAIL-R3 in CD with a significant down-regulation only
observed in fibrostenosing CD (C) (p= 0,0083). No significant difference was observed for
TRAIL (A) and TRAIL-R2 (B) transcripts in the different groups. Data represent the means ±
Tables
Table 1: Characteristics of the Crohn’s disease patients included in IF isolation experiments (n=9)
Age (median, range) 34 (20-50)
Disease duration (months) (median, range) 52 (1-132)
Gender (F/M) 5/4 Location : - Ileal -Colonic -Anal 7 6 2 Treatment : -5ASA -Azathioprine -Glucocorticoids -Antibiotics -Anti-TNF 0 3 4 4 1
Table 2: Sequence of primers
Primers GenBank No.
TRAIL Sens: GAAGCAACACATTGTCTTCTCCAA Antisens: TTGATGATTCCCAGGAGTTTATTTT NM_003810 TRAIL-R2 Sens: GGTTCCAGCAAATGAAGGTGAT Antisens: AGGGCACCAAGTCTGCAAAG NM_003842 TRAIL-R3 Sens: GAAGTGTAGCAGGTGCCCTAGTG Antisens: TGGCACCAAATTCTTCAACACA NM_003841
Table 3a: IF survival after TRAIL stimulation (FCS 10%)
FCS 1% 0 ng/mlTRAIL 10 ng/mlTRAIL 50 ng/mlTRAIL 100 ng/mlTRAIL 500 ng/mlTRAIL
Control 100% 75 ± 11,6% 71 ± 11,7% 71 ± 11,3% 65,6 ± 10,8%*
Non-FS CD 100% 64,1 ± 5,5% # 52 ± 3,8% # 56,1 ± 6% # 51,1 ± 5,4% #
Table 3b: : IF survival after TRAIL stimulation (FCS 1%) FCS 10% TRAIL 0 ng/ml TRAIL 10 ng/ml TRAIL 50 ng/ml TRAIL 100 ng/ml TRAIL 500 ng/ml Control 100% 88,8 ± 4,7% 83,6 ± 9,5% 86 ± 5,3% * 79,5 ± 4%* Non-FS CD 100% 84,6 ± 5,6% 83,4 ± 4,6% * 83,6 ± 5,5% * 77 ± 4,7% * FS CD 100% 71,4 ± 6,9 % # 66,9 ± 6,7% # 66,1 ± 6,7% # 63,7 ± 7% #
Table 3a and 3b. IF survival after TRAIL stimulation with FCS 1% (a) and 10% (b).
Results are expressed in % of cell viability compared to control condition (no TRAIL stimulation) which represents 100%. Data represent the means ± SEM of 4 different experiments performed on 7 controls, 8 non-fibrostenosing (non-FS) CD and 10
fibrostenosing (FS) CD.
# p< 0,01, * p< 0,05.
Table 4: Role of cytokines on IF survival TRAIL
50 ng/ml TRAIL 50ng/ml +IL-1 10 ng/ml TRAIL 50 ng/ml +TNFα 10ng/ml IL-6+SR 10ng/ml TRAIL 50 ng/ml+ TRAIL 50 ng/ml +IL-10 10 ng/ml
Control 71,7 ± 7,14% 76,2 ± 2,28% 81,1 ± 4,16% 86,9 ± 3,8% 83,3 ± 6,7%
non-FS CD 48,6 ± 9,5% 56,9 ± 1,5% * 56,4 ± 1,7% * 62 ± 3,5 %* 55,1 ± 2,5% *
FS CD 43,3 ± 5,5% 47,9 ± 2,1% 48,3 ± 2,4% 54 ± 2,8% * 49,5 ± 3,4%
Table 4. Role of cytokines on IF survival. Results are expressed in % of cell survival as compared to control condition (no stimulation by TRAIL or cytokines). The viability of IF treated with TRAIL 50 ng/ml and cytokines is compared to the viability of IF only treated with TRAIL 50 ng/ml; * p< 0,05.
Data represent the means ± SEM of 3 different experiments performed on 7 controls, 8
