IV. l D écouverte automatique et analyse phylogénétique de nouveaux systèmes TA
IV.3 L e déclin du système TA chromosomique CCD qis ? chez l ' espèce E scherichia cou
Escherichiacou
Si les systèmes TA ne constituent apparemment pas des modules de réponse au stress, comme expliqué en introduction, il semble néanmoins acquis que certains aient une fonction bien particulière (dans le développement, la persistance, la stabilisation de fragments génomiques ou l’anti-addiction).
Les systèmes TA ont de plus toutes les qualités requises pour être des gènes égoïstes, à savoir des gènes qui se maintiennent dans les génomes sans conférer d’avantage sélectif à leur hôte. En effet, une fois présents sur un plasmide ou même dans le chromosome, ils ne peuvent en être « délogés » (par perte du plasmide ou excision de l’opéron chromosomique) sans causer la mort de la cellule par PSK. Cette simple propriété suffirait à expliquer leur ubiquité. Il est d’ailleurs possible que certains soient recrutés par la suite pour une fonction particulière, comme décrit plus haut.
Néanmoins, des gènes dépourvus de fonction ne sont pas soumis aux mêmes pressions de sélection que des gènes essentiels. Ainsi, il est probable d’observer une évolution de type « neutre » à savoir une accumulation de mutations aléatoires, à distinguer de la sélection positive (certaines mutations précises favorisées à des endroits donnés de la séquence) et négative (aucune mutation possible).
Dans le cadre de l’étude de l’évolution des systèmes TA chromosomiques, nous avons
analysé la distribution du système ccdois?, un système homologue au système ccdp du
plasmide F, présent dans le chromosome de la souche E. coli 0157.H7. La question sous-
jacente pourrait être formulée de cette manière : quelles sont les forces qui dirigent l’évolution de ccdois?^ Cette étude a fait l’objet d’une publication [138] que je vais maintenant présenter.
ccdoi57 est localisé entre deux gènes de ménage, folA et apaH. Afin d’étudier la
prévalence de ce système au sein de l’espèce E. coli, cette région intergénique a été examinée
chez 395 isolats à'E. coli représentant en tout 174 sérogroupes différents. Nous avons dans im
premier temps observé que le système ccdois? n’est présent qu’au sein de 137 isolats,
représentant 47 sérogroupes. De plus, la grande diversité de cette région, même au sein d’isolats différents de la même souche, nous porte à croire que cette région est un site privilégié d’intégration de matériel génétique étranger.
Parmi ces 137 isolats présentant un système ccd, un exemplaire de chaque sérogroupe représenté a été séquencé, conduisant donc à 47 séquences. Si nous avons constaté que les gènes de l’antitoxine CcdAois? sont extrêmement bien conservés (7 allèles), ce n’est pas le cas des toxines (14 allèles). En effet, on observe au sein des séquences des gènes de toxines un grand nombre de mutations, qui vont de la simple substitution à la délétion pure et simple d’un fragment à l’extrémité 3’ de la séquence. Par ailleurs, ces toxines tronquées présentent encore des mutations retrouvées au sein d’autres souches. De ce fait, nous nous sommes
demandé si toutes ces toxines sont encore fonctionnelles. Des tests in vivo on révélé que
parmi les 12 testées, 7 de ces toxines ont encore une activité toxique, tandis que toutes les antitoxines sont capables de contrecarrer l’effet de la toxine canonique CcdBois? - sauf ime qui présente un décalage du cadre de lecture. Celle-ci est associée à ime toxine non fonctionnelle.
Nous avons alors voulu estimer les forces de sélection à l’œuvre sur ces séquences. Pour cela, nous avons décidé de considérer plusieurs groupes de séquences : les toxines
CcdBoi57, les antitoxines CcdAois?, les séquences correspondantes des gènes folA et apaH, et
un groupe de toxines CcdBp (homologues plasmidiques de CcdB0157). J’ai reconstruit chacune des phylogénies correspondantes, et grâce à elle, j’ai estimé le ratio co (voir Introduction). Il s’avère que les antitoxines, ainsi que les toxines plasmidiques et les gènes
folA et apaH, sont soumises à une forte sélection négative, empêchant donc toute mutation. Les toxines chromosomiques sont soumises à une sélection neutre, et donc n’importe quelle mutation peut s’y fixer. Cette pression de sélection au niveau de l’antitoxine peut s’expliquer soit par le fait qu’elle soit nécessaire à la survie tant que la toxine est fonctionnelle, et/ou par le fait qu’elle ait une autre fonction au sein de l’organisme (comme la capacité d’antagoniser une toxine d’un système pleismidique, agissant ainsi comme un module d’anti-addiction).
Ceci nous a permis de conclure au déclin du gène ccdBois?- En effet, la seule manière
par laquelle un système TA peut naturellement disparaître commence par une inactivation de la toxine, l’antitoxine étant nécessaire à la survie. Une fois que la toxine a perdu sa toxicité, l’antitoxine peut se retrouver dépourvue de rôle cellulaire et les contraintes de sélection peuvent être relâchées. Dans un premier temps, des mutations non incapacitantes apparaissent, telles que celles retrouvées au sein des toxines fonctionnelles. Puis des mutations, telles que la délétion d’un fi-agment 3’, ôtent à la toxine sa toxicité. Et alors seulement l’antitoxine peut elle aussi être mutée jusqu’à ne plus pouvoir contrecarrer une
toxine canonique, comme c’est le cas de la seule antitoxine non fonctionnelle que nous avons, associée à une toxine inactive.
Ces résultats nous ont permis d’établir un scénario d’évolution de ce système TA. Dans un premier temps, il a été intégré au chromosome à partir de matériel génétique étranger, acquis par l’intermédiaire d’un plasmide conjugatif. Dépourvu de rôle physiologique, et n’étant pas parvenu à être recruté par la bactérie pour remplir un tel rôle, la toxine est en train de disparaître. L’antitoxine peut être maintenue si elle a une autre fonction. Ce scénario est probablement applicable à d’autres systèmes TA chromosomiques. Ces
résultats nous permettent également de proposer l’hypothèse que le système ccd est un
élément génétique égoïste, dépourvu donc de fonction au sein de l’organisme. Il se trouve sur des éléments génétiques mobiles et peut être intégré au chromosome. De là, il peut soit être muté et/ou acquérir un rôle physiologique (tel que T anti-addiction) ou disparaître progressivement.
Conclusion
La théorie du gène égoïste, décrite par Richard Dawkins dans son livre The selfish
gene publié en 1976, prédit notamment qu’un gène peut être ubiquiste, ou juste extrêmement
répandu, sans pour autant apporter d’avantage sélectif à l’organisme qui le porte. En effet, si la sélection naturelle de gènes nécessaires stabilise ceux-ci au sein des génomes, ce n’est pas le seul mécanisme possible de maintien. Si on considère un gène, ou un système de gènes, ayant la faculté naturelle de se rendre indispensable et/ou un bon mécanisme de transmission, celui-ci peut assez facilement envahir une population de génomes.
Les systèmes TA sont donc des candidats idéaux. L’instabilité de l’antitoxine, par rapport à celle de la toxine, fait qu’ime fois présent au sein d’un organisme, celui-ci doit le transmettre à sa descendance afin qu’elle survive. De plus, les mécanismes de transfert horizontal de gènes, notamment via les plasmides, assurent aux systèmes TA plasmidiques une transmission parfois inter-spécifique. Si on associe cela à la possibilité que des gènes plasmidiques soient intégrés au chromosome, cela suffit à expliquer la présence quasi- systématique des systèmes TA chez les procaryotes.
Malgré sa simplicité, cette explication est assez mal perçue, la vision traditionnelle étant que lorsque l’on retrouve un gène au sein de nombreux génomes, c’est que celui-ci a ime
canoniques chez E. coli, et l’étude précédemment décrite) prouvent qu’au moins certains d’entre eux sont dépourvus de fonction biologique. Ceci n’est pas incompatible avec les autres travaux mentionnés en introduction et décrivant des systèmes impliqués dans différents
processus cellulaires ; par ailleurs, le système ccd constitue peut être juste un cas particulier.
D’un point de vue évolutif, il est tout à fait logique qu’en tant que gènes égoïstes, les systèmes TA finissent par disparaître, une fois la toxine rendue inactive par mutation. De ce fait, le seul moyen pour un système TA, une fois intégré dans un génome, de survivre serait d’être recruté à une tâche particulière. Ce sont de tels systèmes dont les fonctions ont été décrites en introduction.
Pour le moment, la question de l’origine des systèmes TA a été abordée d’un point de vue fonctionnel. En effet, nous nous sommes demandé quel(s) type(s) de gène a(ont) pu
évoluer pour donner la diversité actuelle. Néanmoins, le fait que la région folA-apaH ne
présente pas toujours de système TA, même au sein de souches de la même espèce, amène à se demander si l’insertion à cet endroit d’vm système s’est faite une fois, au sein d’un ancêtre commun, ou plusieurs fois au cours de l’évolution. La deuxième hypothèse suggère donc que l’origine « physique » des systèmes TA chromosomiques pourrait être les éléments génétiques mobiles (EGM), et que des sites d’insertion spécifiques pourraient exister. Les travaux, décrits ci-après, que nous avons démarré ont pour vocation de répondre notamment à cette question.
Copyright © 2009 by thc Gcnetics Sodcty of America DOI: 10.1534/genetics.l08.095190
The Decay of the Chromosomally Encoded ccdois
7Toxin-Antitoxin System
in the Escherichia coli Species
Natacha Mine, Julien Guglielmini, Myriam WUbaux and Laurence Van Melderen'
Laboratoire de Génétique et Physiologie Bactérienne, Institut de Biologw et Médecine Moléculaires, Faculté des Sciences, Université Libre de Bruxelles, 6041 Gosselies, Belgyum
Manuscript received August 18, 2008 Accepted for publication Januaiy 27, 2009
ABSTRACT
The origin and the évolution of toxin-antitoxin (TA) Systems remain to be uncovered. TA Systems are abundant in bacterial chromosomes and are thought to be part of the flexible genome that originates from horizontal gene transfer. To gain insight into TA System évolution, we analyzed the distribution of the chromosomally encoded ccdoisy System in 395 natural isolâtes of Escherichia coli. It was discovered in the E. coli
0157:H7 strain in which it constitutes a genomic islet between two core genes (folA and apaH). Our study revealed that the folA-apaHintergenic région is plastic and subject to insertion of foreign DNA. It could be composed (i) of a répétitive «xtragenic palindromie (REP) sequence, (ii) of the ccdoisr System or subtle variants ofit, (iii) ofalarge DNApiece thatcontaineda cc<Moi57andtoxin remnantin association with ORFs of unknown function, or (iv) of a variant of it containing an insertion sequence in the ccdAoisy remnant. Sequence analysis and functional tests of the ccdoisr variants revealed that 69% of the variants were composed of an active toxin and antitoxin, 29% were composed of an active antitoxin and an inactive toxin, and in 2% of the cases both ORFs were inactive. Molecular évolution analysis showed that ccdBois? is under neutral évolution, suggesting that this system is devoid of any biological rôle in the E. coli species.
B
ACTERIAL chromosomes and plasmids harbor, often in multiple copies, addiction modules also known as toxin-antitoxin (TA) Systems (for a review, see Gerdeset al 2005). They generally consist of two genes: a toxin-encoding gene whose product affects the bacterial metabolism (réplication or translation) and an anti- toxin-encoding gene whose product binds to the toxin and counteracts its activity. The antitoxin is constantly degraded by an ATP-dependent protease while the toxin is a stable protein. This property rentiers the cell addicted to antitoxin production and therefore to the TA genes. This has been well documented for plasmid-encoded TA Systems. Their biological rôle is to help maintain plasmids in growing bacterial populations by killing plasmid-free daughter bacteria (addiction phenomenon or postsegre- gationalkilling,PSK) (Gerdesétal 1986;Yarmolinsky 1995). The function (s) of chromosomtdly encoded TA Systems, however, still remains unclear. While it was proposed that chromosomally encoded wazEFand relBESystems of Escherichia coli K-12 are stress response modules, it was recently shown that the five canonical TA Systems ofE. coli K-12 (including relBEznA mazEF) do not confer any sélective advantage under a variety of stress conditions (Christensen et al 2003; Kolodkin- GALandENGELBERG-KuLKA 2006; TsiLiBARisef aZ. 2007).
' Corresponding author: Laboratoire de Génétique et Physiologie Bactéri enne, Institut de Biologie et Médecine Moléculaires, Faculté des Sciences, Université Libre de Bruxelles, 12 rue des Professeurs Jeener et Brachet,
This raises the distinct possibility that chromosomally encoded TA Systems might be devoid of function, at least in the global stress response. Nevertheless, recentstudies hâve highlighted a variety of physiological processes in- volving chromosomally encoded TA Systems such as developmental programming (Nariya and Inoxtye 2008), persistence (Keren et al 2004), stabilization of large genomic fragments (Szekeres et al 2007), and anti addiction (Saavedra De Bast et al 2008). Thus, the fonctions of chromosomally encoded TA Systems are likely to be quite diverse, depending on the type of TA Systems, their genomic location (plasmid, genomic island, chromosomal core), and their host species.
Seven families of TA Systems hâve been defined on the basis of the homology of the toxin proteins (Pandey and Gerdes 2005). One of the striking features of these Systems is their wide distribution in bacterial and archeal genomes. Most of the genomes that hâve been sequen- ced do contain TA Systems (Pandey and Gerdes 2005; Sevin and Barloy-Hubler 2007) although to varions extents. Some of the TA families are highly prévalent (such as relBE and vapBQ while others appear to be less represented (phd-doc 3nd ccd) (Pandey and Gerdes 2005). The ccd family is mostly confined to 7-proteobacteria and only a small number of chromosomally encoded homologs hâve been identified and studied so far
(WiLBAUX et al 2007; Saavedra De Bastet al 2008).
1558 N. Mine et al.
ized in E. coli 0157:H7 EDL933 and found to be
expressed and still functional (Wilbaux et al. 2007). Indeed, the ectopic expression of this CcdBois? toxin is léthal through gyrase poisoning, while the coexpression of the CcdAoi57 antitoxin relieves its toxicity. The
ccdoi57 System is located between the folA and apaH
metabolic genes, coding, respectively, for a dihydrofo- late reductase and a diadenosine tetraphosphatase. Bio- informatics analysis on E. coli genomic sequences available at the time (17 partial or complété sequences) indicated a certain degree of plasticity in this région (Wilbaux et al. 2007). In the présent work, we hâve analyzed the/oZA-a/>a//intergenic région of a collection of 395 E. coli isolâtes representing the 174 known sero- groups. The aim of this study is to evaluate the pre- valence of the chromosomally encoded ccdois? System within E. coli species and to gain insight into the évolution of TA Systems.
MATERIALS AND METHODS
Bacterial strains: E. coli strains used in this work, their origin, and their pathogenic or commensal nature are listed in supplé mentai Table SI. Three hundred ninety-five E. coli strains were obtained from varions sources. Sixty-nine strains were ob- tained from academie hospitals (48 from the Hôpital Universi taire des Enfants Malades Reine Fabiola, Université Libre de Bruxelles, Belgium and 21 from the Academisch Ziekenhuis, Vrije Univers!teit Brussel, Belgium). Three hundred six strains were obtained from collections [2 from the Collection de l’Institut Pasteur, (Paris), 130 from the Shiga Toxin-Producing
Escherichia coli Center (Michigan State University), and 174 from Laboratoiio de Referencia de E. coli (Universidad de Santiago de Compostela, Spain) ]. Eighteen strains were obtained from stools from healthy volunteers and 2 from urine of patients with a diagnosed cystitis. Identification of these 20 strains was con- firmed using the VITEK 2 (BioMérieux, Marcy l’Etoile, France). AU the strains, besides those received from LREC, were sero- grouped using the complété serogrouping kit from LREC. E. coli
serogrouping reUes on the nature of the O antigen. One hundred seventy-four different serogroups hâve been described.
In addition, the MCI 655 (wild-type E. coli K-12) (Gentry
et al. 1991) and the SG22622 (MC4100 cpsB'.'.lacZ ara malP'.'. lacF) (from S. Gottesman) laboratory strains were used.
Media: Luria-Bertani medium (LB) (Miller1972), Ceria 132 synthetic medium (CM), (Glansdorff 1965), and CM supplemented with 0.1% casamino acids (CCM) were used.
DNA manipulations: Transformations with appropriate plasmids were performed as described in Miller (1972), and most routine DNA manipulations were performed as described in Sambrookand Russell(2001).
PCR détection of the ccdot 57 System: Presence of the ccdois?
System was examined in ail our E. coli isolâtes by PCR, using primers flanking the folA-apoH mtergenic région: primer 40- bis (5 '-GCAGAACTCTCACAGCTAri-3 ' ) complementary to the 3'-end of the folA gene and primer 93 (5'-TTGTCCAG CCGTCGAACCGGC-3') complementary to the 3'-end of the
apoHgene (Figure 1 ). The strains presenting a PCR amplicon of 151 bp (which corresponds to a/oM-a/>a//intergenic région of 77 bp) were further screened by PCR with primers complementary to the ccdo/57 System of EDL933 to possibly detect it at different locations. For this purpose, primer 43 (5'- TTGTTCTAGAATTGTACAGGAGCACG-3' ) complementary
P40 P43 P47 P93
Figure 1.—PCR détection of the ccdoisy System in the E. coli
species. The ccdoi57system is located between the folA émd the
apaH gene (not on scale). Its presence was detected by PCR using the P40 and P93 primers that are complementary to the ORFs that are flanking the ccdois7 System. Another set of pri mers (P43 and P47) complementary to the ccdAoj37 and cedBoiszORFs was used to detectit at other potential chromo somal locations in strains that did not carry ccdois7 between
folA and apaH.
to the 5'-end of the ccdAois7 gene and primer 47 (5'-
AGTCTCTGCAGTTAAATCCCGTCGAGC-3 ' ) complemen
tary to the 5 '-end of the ccd£oi57gene were used. As an internai control, primers 16SA (5'-CCCCCTGGACGAAGACTGAC-3') and 16SB (5'-ACCGCTGGCAACAAAGGATA-3') complemen tary to 16S rRNA were used in PCR reactions.
Sequencing of the folA-apoH intergenic région: To ensure a diverse sampling of the E. coli population, the folA-apoH
intergenic région of 93 isolâtes was sequenced using primers 40-bis and 93 (see supplémentai Table SI, in boldface type). The sequence of the 712-bp fragment obtained in 47 different serogroups, as well as that of the 1499-bp fragment in 20 different serogroups, and that of the unique 2778-bp fragment was analyzed. The 151-bp fragment was analyzed for the 25 serogroups that presented a high variability in PCR size. In the case of the 712-bp fragments, the DNA sequence was trans- lated and compared to the CcdAois? and CcdBoisy protein sequences from the E. coli 0157:H7 EDL933 reference strain using BLASTP. For the 1499- and 2778-bp fragments, the ORFs were determined using ORFinder.
Construction of the cedA and ccdB expression plasmids:
pBAD33-derivative plasmids: The variants of the chromosomally encoded ccdBois7 gene were amplified from a boiled colony from the vjirious serotypes using the primers 5'-CcdB0157-AZ)ffiI (5 '-GC rCrAGAAGGAGGTAGCGATGCAATTTACGG-3 ' ) and 3'-CcdB0157-Psfl (5'-AGTCGCrGCAGCTAGAAGCTCCGGT AG3'). The variants of the F-plasmid-encoded cedBf gene were amplified using OLI 70 (fi'-TCTAGAAGGAGGGTGAAATGCA GTTTAAGG-3') and OLI 71 (5'-AGTCGCrGCAGTTATATT CCCCAGAA03'). The 5'-primers (CcdB0157-XiaI and OLI 70) carried a canonical Shine-Dalgamo (SD) sequence (in boldface type). The PCR products were digested with Mal and
Pstl (in italics) and ligated dovmstream of the Paco promoter of the pBAD33 vector eut with the same restriction enzymes. The recombinant plasmids were sequenced. The different variants were named according to the serotype of the strain.
pKK223-3-derivative plasmids: The variants of the chromoso mally encoded ccdAoi;7 gene were amplified on a boiled colony from the various serotypes using the primers 5'-Ccd AOl 57-£coRI (5 '-TTGTGAA7TCTATGACTGCAAAACGTACC A-3') and 3'-CcdA0157-Psfl (fi'-AGTCTCTGCAGCTAGAAG CTCCGGTACTC-3'). The variants of the plasmid-encoded
cedApgene were amplified using P502 (5'-TTGTGAA7TCTAT GAAGCAGCGTATTACAGTGACAG-3') with P516 (5'-AGTCT CrGCAGTCACCAGTC CCTGTTCTC-3'). The PCR products were cloned into the TOPO-XL vector (Invitrogen, Carlsbad, CA) and sequenced. The recombinant TOPO-XL plasmids were then digested with EcoRI éuid Pstl (in italics) and the corresponding DNA fragments were ligated downstream of the lac/tre promoter in the pKK223-3 vector opened with the same restriction enzymes. The recombinant plasmids were
Extinction of the ccdom TA System in the E. coli Species 1559
sequenced. The different variants were named according to the serotype of the strain.
Toxicity and antitoxicity plate assays: To test the toxicity of the cloned CcdBoisv and CcdBp variants, the corresponding pBADSS-ccdB constructs were transformed in MG1655. The resulting transformants were plated on LB plates containing chloramphenicol with or without arabinose (1%). The CcdB variants were considered to be functional (toxic) when trans formants were able to grow only in the absence of arabinose.
To test the ability of the cloned CcdAoisy and CcdAp variants