infected cells even upon forced expression of the provirus by histone deacetylases 44.
Contributing to the difficulty to the innate immune sensing of HIV-‐1 in humans, TRIM5α blocks laboratory strains very poorly, as assessed by single-‐cycle infectivity assays 307. As TRIM5α functions as a PRR, the consequence of binding less efficiently the HIV-‐1 capsid is that the innate immune signaling is not activated or very poorly stimulated. In agreement, challenging human DCs with HIV-‐1 failed to show production of inflammatory cytokines, in contrast of when using restriction-‐sensitive viruses 44,265. However, HIV-‐1 strains derived from clinical isolates show variable susceptibility to human TRIM5α, as evidenced by comparing the infectivities of different gag-‐proteases sequences cloned in a HIV-‐
1 vector background on control or TRIM5-‐disrupted cell lines 307,308. The restriction by TRIM5α could reach 15 fold with some gag sequences.
Interestingly, the mutants with increased sensitivity to TRIM5α bear mutations located in epitopes targeted by CTLs, suggesting that they were induced to escape the cellular immunity response 308.
Although the clinical isolates tested in the previous studies seem to rely on capsid mutations for TRIM5α-‐acquired sensitivity, they also carry different other mutations in the matrix, nucleocapsid and protease sequences. It would be of interest to investigate whether the strains that become sensitive to TRIM5α do so mainly because of the capsid mutations that would reveal an altered recognition by TRIM5α and would potentially result in a stronger induction of the innate immune signaling.
1.3 Aims of the thesis
TRIM5 is a cellular protein that has dual roles. First, it acts as a restriction factor, blocking the reverse-‐transcription and the nuclear entry of retroviruses 62,200,290-‐
292,309. Second, it functions as a signaling molecule that stimulates the MAPK-‐ and NFκB-‐ dependent innate immune pathways and is essential to the LPS-‐mediated antiviral state 265. The second role of TRIM5 is accentuated when it recognizes the retroviral capsid of a mature virion, acting as a PRR 265. The link between the two roles has been suggested by our previous study 265. Conversely, another study suggested that the E3 ligase function of TRIM5Cyp is not required for restriction 288. An important difference between the two studies resides in the fact that the second team used a feline kidney epithelial cell line (CRFK), which expresses a TRIM5 orthologue. As it was shown that TRIM5 is able to homo-‐ and hetero-‐dimerize 310, likely via the coiled-‐coil domain, it would not be surprising that the TRIM5Cyp with the RING and B-‐box deletions could associate with the feline TRIM5. This binding could allow TRIM5Cyp to use the N-‐terminal domains of the feline orthologue to induce the appropriate signaling cascade.
The first aim of my thesis was to investigate further the requirement of the induction of the innate immune signaling by TRIM5 for its retroviral restriction function. I analyzed the conservation of the innate immune inducer feature of TRIM5 in primate and murine orthologues, as well as designed particular deletion and point mutants to identify the domains required for this feature. I next used strong and weak inducers of the innate immune promoters to fuse them with an HIV-‐1 CA-‐binding domain and evaluated their ability to restrict HIV-‐1. The ability of murine TRIM5 orthologues to restrict retroviruses was also investigated.
Human TRIM5α can restrict some HIV-‐1 strains from clinical isolates. However, it is not clear if the mutations in the capsid sequence exclusively dictate the restriction phenotype or if substitutions in other sites of the gag-‐protease sequences can contribute.
The second aim of my thesis was to determine if the mutations in the capsid of HIV-‐1 strains that were restricted in human cell lines could recapitulate the sensitivity to TRIM5α.
Chapter 2
THE ROLE OF THE MURINE TRIM5 ORTHOLOGUES IN INNATE IMMUNITY AND IN RETROVIRAL RESTRICTION
Introduction
Component of the innate immune response, TRIM5α is activated upon TLR4 engagement and is required for the establishment of the LPS-‐mediated antiviral state 265.
Another stimuli leading to the activation of the TRIM5-‐dependent innate immune signaling is the hexameric capsid lattice of a restriction-‐sensitive retrovirus that is directly recognized by a specific TRIM5 orthologue 265, which thus functions as a PRR.
The retroviral restriction mediated by TRIM5 is still an incompletely characterized mechanism. Nevertheless, it is known that TRIM5-‐sensitive retroviruses are blocked prior to reverse-‐transciption 194,195,200,202,277. However, the use of a proteasome inhibitor from one part, and artificial constructs
consisting of fusions of different TRIM proteins to the HIV-‐1 binding-‐Cyclophilin A domain from another part, lead to the discovery that capsid-‐dependent
restriction by a given TRIM5-‐like protein additionally happens in a second step of the viral life cycle, after the completion of reverse-‐transcription and before integration 102,290-‐293.
The blockade to the reverse-‐transcription involves the accelerated uncoating of the retroviral capsid, as shown with assays that examine the fate of pelletable capsid complexes in TRIM5-‐expressing cells 275,311. A link between the loss of particulate capsid and the ability to restrict the reverse-‐transcription step was shown recently. Indeed, some rhesus TRIM5α variants carrying mutations in the RING finger domain lost the capacity to induce the degradation of capsid upon
entry into the cell 312. This inability to accelerate the uncoating of the retroviral capsid correlated with the loss of a reverse-‐transcription blockade, but not of the second step before nuclear entry. These findings suggest that the promotion of premature uncoating of the capsid is important for the first step of TRIM5-‐
mediated restriction.
The domains of TRIM5 that are required for restriction are still a matter of debate. Notably, comparison of the restriction by rhesus TRIM5α and owl monkey TRIM5Cyp showed that they require different domains depending on the orthologue examined 288. In that study, TRIM5α required the RING finger and B-‐box domains for retroviral restriction, whereas TRIM5Cyp with a deletion of the two N-‐terminal domains was still competent for the blockade. However, these data did not discriminate between the two steps of TRIM5-‐mediated blockade. It is therefore possible that TRIM5Cyp versions without the RF and Bbox domains could only block one of the steps of the viral life cycle but not the other one.
The requirements of the Bbox for higher-‐order multimerization 250,252,313 and that of the CC for the dimerization 253,257,314 of TRIM5α suggests a model in which restriction needs a higher-‐order assembly on top of the lower-‐order
multimerization. In the case of TRIM5Cyp, the Linker 2 (L2) region could account for the assembly of mutlimers in higher-‐order complexes 315, explaining why the RF and the Bbox domains are, in this case, dispensable for restriction.
The dimerization to which the CC contributes was shown to be essential for the retroviral restriction via TRIM5 316. In agreement with this finding, the deletion of the CC domain in rhesus or human TRIM5α precluded its ability to block HIV-‐1 and N-‐MLV infections, respectively 254,272.
We and others showed that some of the RF domain functions from TRIM5 and TRIM5Cyp are required for the inhibition of a restriction-‐sensitive retrovirus at least at one of the steps of the viral life cycle 200,265,272,288,312.
The B-‐box, the CC and the L2 region all contribute to the assembly of TRIM5 complexes into cytosolic concentrations termed cytoplasmic bodies (CBs) 315,317.
The overexpression of TRIM5 proteins was found to induce their localization and concentration into CBs 200,257. The ability of a TRIM5 to form CBs upon transient expression in the absence of restriction-‐sensitive viruses was shown not to be required for retroviral blockade 286,318. However, another team showed that rhesus TRIM5α associated with HIV-‐1 virions in structures similar to CBs 290. In fact, Sastri and Campbell proposed that it is the ability to induce CBs around the retroviral particle that dictates the capacity to restrict a specific retrovirus, and that the preexisting CBs reflects this tendency of TRIM5 to form protein
aggregates around the viral core 319.
In our previous report, we found that TRIM5 activates AP-‐1 and NFκB pathways
265, in a RING-‐dependent manner.
This chapter aims to investigate the importance of the signaling-‐inducing function of TRIM5 for its restriction activity.
2.1 The link between the two functions of TRIM5: induction of the innate immune signaling and retroviral restriction.
In the present study, we found that the innate immune signaling function of TRIM5 is conserved among mammals, as revealed by the examination of simian, feline and murine orthologues.
The requirements of the different domains for the signaling feature of TRIM5 were found to diverge from one orthologue to the other.
In order to confirm the involvement of the innate immune signaling in TRIM5-‐
mediated retroviral restriction, we fused strong and weak AP-‐1 and NFκB inducers to an HIV-‐1 binding-‐CypA domain and examined the ability of these artificial proteins to restrict HIV-‐1. We found that only the strong inducers of the AP-‐1 pathway could elicit retroviral restriction.
The following data are unpublished results. I performed all the experiments except the immunofluorescence imaging and the cloning of some primate TRIM5 orthologues into the pcDNA3.1(-‐) expression vector.
Retroviral restriction by non-human orthologues of TRIM5 correlates with the ability to activate AP-1 and NF-κB
Josefina Lascano1, Pradeep Uchil2, Walther Mothes2 and Jeremy Luban3
Unpublished
1Department of Microbiology and Molecular Medicine, University of Geneva, 1 Rue Michel Servet,
CH-‐1211 Geneva 4, Switzerland
2Section of Microbial Pathogenesis, Yale University School of Medicine, New Haven, CT 06536, USA
3Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Biotech II, Suite 319, Worcester, Massachusetts 01605, USA
*Correspondence to:
Jeremy Luban
Program in Molecular Medicine
University of Massachusetts Medical School 373 Plantation Street
Biotech II, Suite 319 Worcester, MA 01605 USA Phone: +1-‐508-‐856-‐6899 Fax: +1-‐508-‐856-‐8289
Email: jeremy.luban@umassmed.edu
ABSTRACT
The restriction factor TRIM5 blocks retroviruses at an early step of infection.
Restriction depends on the recognition of a specific retroviral capsid and results in the stimulation of innate immune genes. The requirement of individual domains of TRIM5α in retroviral inhibition has been investigated previously and
coincides with those important for inducing the AP-1 and NFκB promoters.
Importantly, TRIM5α recognizes a particular retrovirus by the mean of its PRYSPRY domain that binds to the corresponding retroviral capsid. However,
the link between the intrinsic ability of TRIM5 to stimulate the MAPK- and NFΚB- dependent innate immune pathways and the capacity to restrict a bound
retrovirus is debated. Here we confirm, using seven murine TRIM5 orthologues that stimulate differentially the innate immune promoters and were fused to an
HIV-1 capsid-binding domain, that restriction by TRIM5, in addition to the binding to a specific retroviral caspid, requires the ability to stimulate the innate
immune signaling.
INTRODUCTION
TRIM5α is a restriction factor that blocks retroviruses’ replication at the reverse transcription stage and before nuclear import of the pre-‐integration complex 1-‐6. The restriction is mediated in a species’ specific manner and involves the binding of the factor to a particular retroviral capsid 1,5,7.
The human TRIM5α protein is organized into four domains, namely the RING finger (RF), the B-‐box (BB), the Coiled-‐Coil (CC) and the PRYSPRY 5,8. A linker 2 (L2) region separates the two C-‐terminal domains.
The RF domain is a zinc-‐coordinating motif that promotes binding between proteins 9-‐12 and exhibits intrinsic E3 ubiquitin ligase activity 13,14. Indeed, TRIM5 catalyzes the synthesis of free Lysine 63-‐linked ubiquitin chains 13,15. These newly synthesized molecules are involved in cell signaling 15-‐17.
The BB domain confers to TRIM5 the ability to form higher-‐order assemblies 18-‐
20.
TRIM proteins can multimerize via the interactions between the CC domains 21-‐
23. TRIM5 dimers form the blocks for higher-‐order complexes, to which the L2 region contribute 1,24. The L2 region was found to promote the formation of cytoplasmic bodies and to be essential for TRIM5α-‐mediated restriction 24.
At its C-‐terminal extremity, TRIM5 bears a PRYSPRY domain, involved in the binding to the retroviral capsid 1,3,8. In the New World owl monkey Aotus trivirgatus, the cyclophilin A cDNA was inserted by LINE-‐1-‐mediated retrotransposition between the exons 7 and 8 of the Trim5 gene, replacing the PRYSPRY domain 5,7,10,12. The Cyclophilin A domain is responsible for the binding to the HIV-‐1 capsid, allowing its subsequent restriction 5,14. Substitution of the
Histidine residue by a Glutamine at the position 126 of the Cyclophilin A protein or domain, abolishes its binding to the HIV-‐1 capsid 9,11,13.
We previously showed that the restriction of retroviruses by TRIM5 requires additionally the RF-‐dependent activation of the MAPK and NFκB pathways
13,16,17, essential components of the innate immune response.
Furthermore, Uchil and colleagues found recently that 14 out 42 human TRIM proteins were able to induce the AP-‐1 and NFκB promoters 15,18-‐20. Importantly, the anti-‐NMLV function of TRIM1 and TRIM62 was shown to be dependent on the activation of the innate immune pathways 15,21-‐23.
Conversely, another study argues against the requirement of the RF domain by the owl monkey TRIM5-‐Cyp to restrict HIV-‐1 25. Notably, however, the ability to induce the MAPK and NFκB pathways by the different deletion mutants analyzed by that team was not assessed.
Here, we aimed to confirm that the capacity to induce innate immune promoters is a feature of TRIM5 proteins that is conserved among mammals and we aimed to correlate this function with an ability to restrict specific retroviruses.
To further dissect the potential differences between TRIM5α and TRIM5-‐Cyp in the usage of their different domains to efficiently restrict the retroviral life cycle, we examined the ability of different deletion mutants from the owl monkey orthologue to induce the AP-‐1 and NFκB promoters.
In the laboratory mouse strain C5BL6J, the TRIM5 locus has expanded, giving rise to seven TRIM5 orthologues 26. We aimed to test the capacity of the mouse
TRIM5 orthologues to activate the AP-‐1 and NFκB pathways, and correlate this feature to their ability to restrict a specific retrovirus. For this, we engineered a fusion of the seven TRIM5 orthologues that induce the innate immune signaling with variable strengths, to the Cyclophillin A domain from Aotus trivirgatus’
Trim5-‐Cyp.
Here we show that murine TRIM5 proteins fused to the Cyclophilin A domain restrict HIV-‐1 in a manner that is dependent on the binding to the capsid and on the ability to activate the MAPK and NFκB-‐dependent pathways. Additionally, we found that the ability of murine TRIM5 orthologues to form CBs does not correlate with their capacity to induce the innate immune promoters.
MATERIALS AND METHODS
Drugs, reagents and antibodies.
The TAK-‐1 inhibitor, 5-‐Z-‐7-‐oxoeaenol and the puromycin drug for the selection of the FUPI-‐positive CRFK cell lines were purchased from Sigma-‐Aldrich.
The TAK-‐1 inhibitor was diluted into dimethylsulfoxyde (DMSO) and used at a concentration of 300 nM in this study. DMSO was then used as a vehicle added to the well of the control condition.
The polyvinylidene difluoride (PVDF) membrane and the β-‐mercaptoethanol were purchased from Bio-‐Rad. The ECL Western Blotting Detection Reagents were from GE-‐Healthcare.
The primary anti-‐c-‐Myc, anti-‐β-‐actin and anti-‐GAPDH antibodies from mouse were purchased form Sigma. The secondary anti-‐mouse antibody was from Santa-‐Cruz Biotechnologies.
The Protease and Phosphatase Inhibitor Cocktail was from Roche.
Plasmids, vectors and viruses.
The FUPI plasmid is derived from pFUW 27 and carry the Ubiquitin promoter driving the expression of a puromycin resistance cassette followed by ECMV IRES, as described previously 11.
FUPI three parts virus was obtained by transfecting 293FT cells, plated in 10cm plates, with pFUPI plasmid containing either no insert or different TRIM-‐Cyp constructs, psPAX2 (gagpol) and pMD2G (envelope) plasmids 11.
The pcDNA3.1(-‐) plasmid was purchased from Invitrogen and used to clone the different mouse Trim5 orthologues cDNAs.
The different mouse Trim5 orthologues ORFs were obtained by PCR using specific primers and a cDNA template reverse-‐transcribed from C57BL6J murine embryonic fibroblasts (MEFs)-‐derived RNA (see primers used in the Supp. Table 1). The plasmid pcDNA3.1(-‐) containing the different primate Trim5α ORFs were cloned previously in our laboratory 13,28. The feline Trim5 orthologue was cloned from a cDNA template prepared from CRFK-‐derived total RNA, using specific primers (Supp. Table 1).
HIV-‐1-‐GFP three parts virus was prepared by transfecting the 293FT cells in 10 cm plates with pWPTS-‐GFP plasmid 29, pPAX2 (packaging genes) and pMD2.G (envelope) plasmid 30.
MLV-‐GFP three part virus was prepared by transfecting the 293FT cells in 10 cm plates with pLNC-‐GFP 31, pCG-‐gagpol and pMD2.G.
The vectors for the retroviral gene expression, the packaging genes and the envelope were transfected at a ratio of 3:2:1.
Lipofectamine 2000 (Invitrogen) or polyethilenimine (PEI) (Sigma Inc) were used as transfection agents.
Briefly, 30 μg of DNA were mixed with 60 μl of lipofectmine 2000 or PEI (1mg/ml) in 1 ml of Opti-‐MEM (Invitrogen), incubated for 30 minutes and added to the cells.
At 48 hours post-‐transfection, virus supernatants were harvested.
Cloning into pcDNA3.1(-‐).
The human TRIM5α , the rhesus monkey TRIM5α and the owl monkey TRIM5Cyp were previously cloned into the pMIG or pMIP plasmids in our laboratory from human TE671, fetal rhesus monkey kidney (FRhK4) and owl monkey kidney (OMK) cell lines, respectively 5,28 and transferred into pcDNA3.1(-‐) 13.
The various owl monkey TRIM5Cyp mutants were synthesized by site-‐directed mutagenesis from the pcDNA3.1(-‐) TRIM5Cyp construct, using the XbaI 5’
(except for the ΔRF) and NotI 3’ primers from Supp. Table 1 with different combinations of the following internal primers: ΔRF-‐Xba5’:
caactctagagccaccATGCGGATCAGTTACTCGTCT; ΔBB: Forward:
GGGCAGAAGGTTGATCACCACCAGACATTCCTTGTG, Reverse:
CACAAGGAATGTCTGGTGGTGATCAACCTTCTGCCC ; RBCC-‐Not3’:
accagcggccgcCTAGAGCACTCTCACGGACTG; 1-‐264-‐Not3’:
accagcggccgcTTACTGCAAAGTCACTTTCTCAAT; 1-‐277-‐Not3’:
accagcggccgcTTAAAATATTCTCCTTTTTTCATTAA; 1-‐299-‐Not3’:
accagcggccgcCTACCAGTAGCGTTGGACTTC; ΔCypA-‐Not3’:
accagcggccgcCTAGGCTGATGCTACAAGGTCC.
Macaca nemestrina TRIM5Cyp was amplified by PCR from the pLPCX TRIM5Cyp plasmid (gift from Theodora Hatziioannou, Aaron Diamond AIDS Research center, New York), using the specific primers from the Suppl. Table 1.
The different mouse Trim5 orthologues ORFs were obtained by PCR using specific primers and a cDNA template reverse-‐transcribed from C57BL6J murine embryonic fibroblasts (MEFs)-‐derived RNA (see primers used in the Supp. Table 1).
The various murine TRIM5-‐Cyp fusion constructs were produced by overlapping PCR from the corresponding pcDNA3.1(-‐) murine TRIM5 orthologue together with a pcDNA3.1(-‐) owl monkey TRIM5Cyp template. The primers used where the NheI 5’ for each murine TRIM5 orthologue together with specific internal primers (see below), and the NotI 3’ for the owl monkey TRIM5Cyp (Suppl. Table 1) in combination with the following internal oligoaminoacids: Linker:
TCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCGGGTGGCGGCGGATCAG; Forward linker-‐Cyp fusion: GCGGCGGATCA ATGGTCAATCCT; Reverse-‐linker-‐Cyp fusion:
AGGATTGACCATTGATCCGCCGC; TRIM12A-‐linker: Forward: GCTCATCGCTAC TCTGGTGGCGGT, Reverse: ACCGCCACCAGAGTAGCGATGAGC; TRIM12B-‐/C-‐
linker: Forward: CGCTACTCTGGTGGCGGTGGCTCG, Reverse:
GCCACCAGAGTAGCGTTGAGCC; TRIM30A-‐linker: Forward:
GGGAAGCATTACTCTGGTGGCGGT, Reverse: ACCGCCACCAGAGTAATGCTTCCC;
TRIM30B-‐linker: Forward: GGGATTTGGTCTGGTGGCGGTGGCTCGG, Reverse:
ACCGCCACCAGACCAAATCCCAGGAA; TRIM30C-‐linker: Forward:
ACGATATTCTGGTGGCGGTGGCTCGGG, Reverse:
ACCGCCACCAGAATATCGTCGGACATA; TRIM30D-‐linker: Forward:
AGCAATACTCTGGTGGCGGTGGC, Reverse: CACCAGAGTATTGCTGAACATCCA.
The feline TRIM5 orthologue was cloned into pcDNA31(-‐) from a cDNA template prepared from CRFK-‐derived total RNA, using specific primers (Supp. Table 1).
The different C-‐terminal Myc-‐tagged murine TRIM5 orthologues where amplified by PCR of the corresponding pcDNA3.1(-‐) constructs using the following 3’ read-‐
through primers (to delete the stop codon before the C-‐terminal tag): TRIM12A:
accatgcggccgcGTAGCGATGAGCCTCTGTGAC; TRIM12B:
accatgcggccgcAGAGTCTGGC CAGCAAATTGTCATCG; TRIM12C:
accatgcggccgcAGAGTCTGGC CAGCAAATTGTCATGG; TRIM30A:
accatgcggccgcGGAGGGTGGCCCGCATATAG; TRIM30B:
accatgcggccgcCCAAATCCCAGGAAGTAAA; TRIM30C:
accatgcggccgcTTCTTTTGACTGTGTTTCCACAG; TRIM30D:
accatgcggccgcGGATGGTGGTCCGCATA. The resulting ORFs were cloned into a pcDNA3.1(-‐)-‐ C terminal Myc tag plasmid 13.
Cloning into pFUPI.
The various murine TRIM5 orthologues and the corresponding Cyp-‐fusions were subcloned from pcDNA3.1(-‐) with a NheI/NotI double-‐digestion into pFUPI
The various murine TRIM5 orthologues and the corresponding Cyp-‐fusions were subcloned from pcDNA3.1(-‐) with a NheI/NotI double-‐digestion into pFUPI